Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ISG20L2-interferon stimulated exonuclease gene 20kDa-like 2 Gene
PTXBC000575
New product
Data sheet of ISG20L2-interferon stimulated exonuclease gene 20kDa-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ISG20L2-interferon stimulated exonuclease gene 20kDa-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000575 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ISG20L2 |
| Origin species: | Human |
| Product name: | ISG20L2-interferon stimulated exonuclease gene 20kDa-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC000575 |
| Gene id: | 81875 |
| Gene description: | interferon stimulated exonuclease gene 20kDa-like 2 |
| Synonyms: | HSD38; interferon-stimulated 20 kDa exonuclease-like 2; interferon stimulated exonuclease gene 20kDa like 2; interferon stimulated exonuclease gene 20 like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctactttactgctcaatctggattttggggaacctcctcccaaaaaggcattagaaggaaatgccaagcaccgaaattttgtcaagaagcggaggctcttagaacggagaggctttctgagtaaaaagaaccaaccccctagcaaggcgcctaagttgcactctgaaccttcaaagaaaggggaaactcctacggtcgatggcacttggaagaccccttccttcccaaaaaagaagacagctgcttccagcaatgggtcaggacagcccctggacaagaaagctgcagtgtcttggttgacccctgccccttcaaaaaaggctgattctgttgctgctaaagtagatttgctgggggagttccagagtgcccttccaaagatcaatagccacccaacccgctctcagaagaagagctcccagaagaaatcctctaaaaagaaccatcctcagaagaatgccccacagaactccacccaagctcattcagagaataaatgctccggagcatcccagaagttgccacggaagatggtggcaattgactgtgagatggtgggcacaggaccaaaggggcatgttagttccttggctcgatgtagcattgtcaactacaacggagatgtgctttatgacgagtacattcttcccccctgccacattgtggactaccgaaccaggtggagtggtatccggaagcagcacatggtgaatgccacacccttcaagattgctcgaggccagatcttgaagatactcacagggaagatagtggtggggcatgccatccacaacgacttcaaagcccttcagtactttcaccccaagtccctcacccgtgacacctcccatatcccccccctcaaccggaaggctgactgcccggagaatgccaccatgtctctgaagcatctcaccaagaagctgctaaaccgggatatccaggttgggaagagcggacattcctctgtggaagatgcccaggccaccatggagctatataagttggttgaagtcgagtgggaagagcacctagcccggaatccccctacagactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dopamine beta-hydroxylase (dopamine beta-monooxygenase) - protein phosphatase, EF-hand calcium binding domain 1 - PI-3-kinase-related kinase SMG-1 isoform 1 homolog - cytoplasmic polyadenylation element binding protein 3 |