EIF3K-eukaryotic translation initiation factor 3, subunit K Gene View larger

EIF3K-eukaryotic translation initiation factor 3, subunit K Gene

PTXBC001031

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF3K-eukaryotic translation initiation factor 3, subunit K Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF3K-eukaryotic translation initiation factor 3, subunit K Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001031
Product type: DNA & cDNA
Ncbi symbol: EIF3K
Origin species: Human
Product name: EIF3K-eukaryotic translation initiation factor 3, subunit K Gene
Size: 2ug
Accessions: BC001031
Gene id: 27335
Gene description: eukaryotic translation initiation factor 3, subunit K
Synonyms: ARG134; EIF3-p28; EIF3S12; HSPC029; MSTP001; PLAC-24; PLAC24; PRO1474; PTD001; eukaryotic translation initiation factor 3 subunit K; eIF-3 p28; eukaryotic translation initiation factor 3, subunit 12; muscle specific; muscle-specific gene M9 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgatgtttgagcagatgagagccaacgtgggcaagttgctcaagggtatcgacaggtacaatcctgagaacctggccaccctggagcgctatgtagagacgcaggccaaggaaaatgcctatgatctggaagccaacctggctgtcctgaagctgtaccagttcaacccagccttctttcagaccacggtcaccgcccagatcctgctgaaggccctcaccaacttgccgcacacagacttcaccctgtgcaagtgcatgatcgaccaggcacatcaagaagaacggccaatccgacagattttgtacctcggggacctgctggagacctgccatttccaggccttctggcaagccctggatgaaaacatggacctcttggaaggtataactggctttgaagactctgtccgaaagtttatctgccatgttgtgggtatcacttaccagcacattgaccgctggctgctggccgagatgctcggggatctgtcggacagccagctaaaggtgtggatgagcaaatacggctggagtgccgacgagtcggggcagatcttcatctgtagccaagaagagagcattaaacccaagaacattgtggagaagattgactttgacagtgtgtccagcatcatggcctcctcccagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, beta type, 1
- cleavage and polyadenylation specific factor 4, 30kDa
- proteasome (prosome, macropain) subunit, beta type, 7
- nucleophosmin (nucleolar phosphoprotein B23, numatrin)

Buy EIF3K-eukaryotic translation initiation factor 3, subunit K Gene now

Add to cart