Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNAJB3-DnaJ (Hsp40) homolog, subfamily B, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJB3-DnaJ (Hsp40) homolog, subfamily B, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017590 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJB3 |
| Origin species: | Human |
| Product name: | DNAJB3-DnaJ (Hsp40) homolog, subfamily B, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC017590 |
| Gene id: | 414061 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily B, member 3 |
| Synonyms: | HCG3; dnaJ homolog subfamily B member 3; DnaJ (Hsp40) homolog, subfamily B, member 3; DnaJ heat shock protein family (Hsp40) member B3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggactactacgaggtgctggacgtgccccggcaggcctcatccgaggccatcaagaaggcgtaccgcaagctggcgctcaagtggcaccccgacaaaaaccctgagaacaaggaggaagcggagaggagattcaagcaggtggccgaggcctacgaggtgttgtcggacgccaagaaacgcgatatctatgaccgctatggcgaggcgggcgcggagggcggctgcacaggcggcaggcccttcgaggaccccttcgagtacgtcttcagcttccgcgacccagccgacgtcttcagggagttcttcggcggccaggacccattctcctttgacctcttgggaaacccgctggagaatattttgggggggtcagaggaactgctggggaagcagaagcagagcgtctgcaccccttttctctgccttcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - La ribonucleoprotein domain family, member 2 - cyclin-dependent kinase 2-interacting protein - serine/threonine/tyrosine interacting protein - cell growth regulator with EF-hand domain 1 |