Login to display prices
Login to display prices
TPD52L1-tumor protein D52-like 1 Gene View larger

TPD52L1-tumor protein D52-like 1 Gene

PTXBC002375

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPD52L1-tumor protein D52-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TPD52L1-tumor protein D52-like 1 Gene

Proteogenix catalog: PTXBC002375
Ncbi symbol: TPD52L1
Product name: TPD52L1-tumor protein D52-like 1 Gene
Size: 2ug
Accessions: BC002375
Gene id: 7164
Gene description: tumor protein D52-like 1
Synonyms: D53; tumor protein D53; tumor protein D52-like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcgcaggcacaaggtttgttggagactgaaccgttgcaaggaacagacgaagatgcagtagccagtgctgacttctctagcatgctctctgaggaggaaaaggaagagttaaaagcagagttagttcagctagaagacgaaattacaacactacgacaagttttgtcagcgaaagaaaggcatctagttgagataaaacaaaaactcggcatgaacctgatgaatgaattaaaacagaacttcagcaaaagctggcatgacatgcagactaccactgcctacaagaaaacacatgaaaccctgagtcacgcagggcaaaaggcaactgcagctttcagcaacgttggaacggccatcagcaagaagttcggagacatgagttactccattcgccattccataagtatgcctgctatgagacgaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: