Login to display prices
Login to display prices
IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene View larger

IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene

PTXBC009696

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene

Proteogenix catalog: PTXBC009696
Ncbi symbol: IFITM2
Product name: IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene
Size: 2ug
Accessions: BC009696
Gene id: 10581
Gene description: interferon induced transmembrane protein 2 (1-8D)
Synonyms: 1-8D; DSPA2c; interferon-induced transmembrane protein 2; dispanin subfamily A member 2c; interferon-inducible protein 1-8D; interferon induced transmembrane protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccacattgtgcaaaccttctctcctgtcaacagcggccagcctcccaactacgagatgctcaaggaggagcaggaagtggctatgctgggggcgccccacaaccctgctcccccgacgtccaccgtgatccacatccgcagcgagacctccgtgcctgaccatgtcgtctggtccctgttcaacaccctcttcatgaacacctgctgcctgggcttcatagcattcgcctactccgtgaagtctagggacaggaagatggttggcgacgtgaccggggcccaggcctatgcctccaccgccaagtgcctgaacatctgggccctgattttgggcatcttcatgaccattctgctcgtcatcatcccagtgttggtcgtccaggcccagcgatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: