Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene
PTXBC009696
New product
Data sheet of IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009696 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFITM2 |
| Origin species: | Human |
| Product name: | IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene |
| Size: | 2ug |
| Accessions: | BC009696 |
| Gene id: | 10581 |
| Gene description: | interferon induced transmembrane protein 2 (1-8D) |
| Synonyms: | 1-8D; DSPA2c; interferon-induced transmembrane protein 2; dispanin subfamily A member 2c; interferon-inducible protein 1-8D; interferon induced transmembrane protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaccacattgtgcaaaccttctctcctgtcaacagcggccagcctcccaactacgagatgctcaaggaggagcaggaagtggctatgctgggggcgccccacaaccctgctcccccgacgtccaccgtgatccacatccgcagcgagacctccgtgcctgaccatgtcgtctggtccctgttcaacaccctcttcatgaacacctgctgcctgggcttcatagcattcgcctactccgtgaagtctagggacaggaagatggttggcgacgtgaccggggcccaggcctatgcctccaccgccaagtgcctgaacatctgggccctgattttgggcatcttcatgaccattctgctcgtcatcatcccagtgttggtcgtccaggcccagcgatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interferon induced transmembrane protein 3 (1-8U) - ATG12 autophagy related 12 homolog (S. cerevisiae) - trimethylguanosine synthase homolog (S. cerevisiae) - actin related protein 2/3 complex, subunit 5-like |