IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene View larger

IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene

PTXBC009696

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009696
Product type: DNA & cDNA
Ncbi symbol: IFITM2
Origin species: Human
Product name: IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene
Size: 2ug
Accessions: BC009696
Gene id: 10581
Gene description: interferon induced transmembrane protein 2 (1-8D)
Synonyms: 1-8D; DSPA2c; interferon-induced transmembrane protein 2; dispanin subfamily A member 2c; interferon-inducible protein 1-8D; interferon induced transmembrane protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccacattgtgcaaaccttctctcctgtcaacagcggccagcctcccaactacgagatgctcaaggaggagcaggaagtggctatgctgggggcgccccacaaccctgctcccccgacgtccaccgtgatccacatccgcagcgagacctccgtgcctgaccatgtcgtctggtccctgttcaacaccctcttcatgaacacctgctgcctgggcttcatagcattcgcctactccgtgaagtctagggacaggaagatggttggcgacgtgaccggggcccaggcctatgcctccaccgccaagtgcctgaacatctgggccctgattttgggcatcttcatgaccattctgctcgtcatcatcccagtgttggtcgtccaggcccagcgatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon induced transmembrane protein 3 (1-8U)
- ATG12 autophagy related 12 homolog (S. cerevisiae)
- trimethylguanosine synthase homolog (S. cerevisiae)
- actin related protein 2/3 complex, subunit 5-like

Buy IFITM2-interferon induced transmembrane protein 2 (1-8D) Gene now

Add to cart