Login to display prices
Login to display prices
NUTF2-nuclear transport factor 2 Gene View larger

NUTF2-nuclear transport factor 2 Gene

PTXBC002348

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUTF2-nuclear transport factor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUTF2-nuclear transport factor 2 Gene

Proteogenix catalog: PTXBC002348
Ncbi symbol: NUTF2
Product name: NUTF2-nuclear transport factor 2 Gene
Size: 2ug
Accessions: BC002348
Gene id: 10204
Gene description: nuclear transport factor 2
Synonyms: NTF-2; PP15; nuclear transport factor 2; placental protein 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagacaagccaatttgggagcagattggatccagcttcattcaacattactaccagttatttgataatgatagaacccaactaggcgcaatttacattgacgcgtcatgccttacgtgggaaggacaacagttccaggggaaagctgccattgtggagaagttgtctagccttccgttccagaaaattcagcacagcatcaccgcgcaggaccatcagcccactccagatagctgcatcatcagcatggttgtgggccagcttaaggcggatgaagaccccatcatggggttccaccagatgttcctattaaagaacatcaacgatgcttgggtttgcaccaatgacatgttcaggctcgccctgcacaactttggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice