Login to display prices
Login to display prices
TBRG1-transforming growth factor beta regulator 1 Gene View larger

TBRG1-transforming growth factor beta regulator 1 Gene

PTXBC032312

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TBRG1-transforming growth factor beta regulator 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TBRG1-transforming growth factor beta regulator 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032312
Product type: DNA & cDNA
Ncbi symbol: TBRG1
Origin species: Human
Product name: TBRG1-transforming growth factor beta regulator 1 Gene
Size: 2ug
Accessions: BC032312
Gene id: 84897
Gene description: transforming growth factor beta regulator 1
Synonyms: NIAM; TB-5; transforming growth factor beta regulator 1; nuclear interactor of ARF and MDM2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcctgctggacggcctcgcttcctcgccgcgggctccgctgcagtccagcaaggccaggatgaaaaagctcccgaagaagagccagaatgagaagtaccggctgaagtacctgcggctgcgcaaagcggccaaggccacggtgtttgtgagtctgacccacgttcagccggtcccctcctggagactccctcacaaaatctttccccaagctgttcccccttcccagtgtgacagtattaatacagtgttggcttttccgtatacgttactacttgttagccttgtgtccttggacaaattacgtaatttctctgtgtcctcatctgtaaatgagctagtaactgtcttgcagaataatgaatattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - T cell receptor gamma variable 7 pseudogene
- proline-rich nuclear receptor coactivator 2
- interleukin enhancer binding factor 3, 90kDa
- non-metastatic cells 3, protein expressed in