C10orf35-chromosome 10 open reading frame 35 Gene View larger

C10orf35-chromosome 10 open reading frame 35 Gene

PTXBC013587

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf35-chromosome 10 open reading frame 35 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf35-chromosome 10 open reading frame 35 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013587
Product type: DNA & cDNA
Ncbi symbol: C10orf35
Origin species: Human
Product name: C10orf35-chromosome 10 open reading frame 35 Gene
Size: 2ug
Accessions: BC013587
Gene id: 219738
Gene description: chromosome 10 open reading frame 35
Synonyms: uncharacterized protein C10orf35; chromosome 10 open reading frame 35
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcggatcttggccaatggggaaatcgtgcaggatgacgacccccgagtgaggaccactacccagccaccaagaggtagcattcctcgacagagcttcttcaataggggccatggtgctcccccagggggtcctggcccccgccagcagcaggcaggtgccaggctgggtgctgctcagtcccccttcaatgacctcaaccggcagctggtgaacatgggctttccgcagtggcatctcggcaaccatgctgtggagccggtgacctccatcctgctcctcttcctgctcatgatgcttggtgttcgtggcctcctcctggttggccttgtctacctggtgtcccacctgagtcagcggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 182
- chromosome 15 open reading frame 40
- chromosome 21 open reading frame 77
- aspartic peptidase, retroviral-like 1

Buy C10orf35-chromosome 10 open reading frame 35 Gene now

Add to cart