Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene
PTXBC001721
New product
Data sheet of SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001721 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRPD1 |
| Origin species: | Human |
| Product name: | SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene |
| Size: | 2ug |
| Accessions: | BC001721 |
| Gene id: | 6632 |
| Gene description: | small nuclear ribonucleoprotein D1 polypeptide 16kDa |
| Synonyms: | HsT2456; SMD1; SNRPD; Sm-D1; small nuclear ribonucleoprotein Sm D1; Sm-D autoantigen; small nuclear ribonucleoprotein D1 polypeptide 16kDa pseudogene; snRNP core protein D1; small nuclear ribonucleoprotein D1 polypeptide |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctcgtgagatttttgatgaaattgagtcatgaaactgtaaccattgaattgaagaacggaacacaggtccatggaacaatcacaggtgtggatgtcagcatgaatacacatcttaaagctgtgaaaatgaccctgaagaacagagaacctgtacagctggaaacgctgagtattcgaggaaataacattcggtattttattctaccagacagtttacctctggatacactacttgtggatgttgaacctaaggtgaaatctaagaaaagggaagctgttgcaggaagaggcagaggaagaggaagaggaagaggacgtggccgtggcagaggaagagggggtcctaggcgataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, beta type, 2 - eukaryotic translation initiation factor 3, subunit K - proteasome (prosome, macropain) subunit, beta type, 1 - cleavage and polyadenylation specific factor 4, 30kDa |