SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene View larger

SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001721
Product type: DNA & cDNA
Ncbi symbol: SNRPD1
Origin species: Human
Product name: SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene
Size: 2ug
Accessions: BC001721
Gene id: 6632
Gene description: small nuclear ribonucleoprotein D1 polypeptide 16kDa
Synonyms: HsT2456; SMD1; SNRPD; Sm-D1; small nuclear ribonucleoprotein Sm D1; Sm-D autoantigen; small nuclear ribonucleoprotein D1 polypeptide 16kDa pseudogene; snRNP core protein D1; small nuclear ribonucleoprotein D1 polypeptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctcgtgagatttttgatgaaattgagtcatgaaactgtaaccattgaattgaagaacggaacacaggtccatggaacaatcacaggtgtggatgtcagcatgaatacacatcttaaagctgtgaaaatgaccctgaagaacagagaacctgtacagctggaaacgctgagtattcgaggaaataacattcggtattttattctaccagacagtttacctctggatacactacttgtggatgttgaacctaaggtgaaatctaagaaaagggaagctgttgcaggaagaggcagaggaagaggaagaggaagaggacgtggccgtggcagaggaagagggggtcctaggcgataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, beta type, 2
- eukaryotic translation initiation factor 3, subunit K
- proteasome (prosome, macropain) subunit, beta type, 1
- cleavage and polyadenylation specific factor 4, 30kDa

Buy SNRPD1-small nuclear ribonucleoprotein D1 polypeptide 16kDa Gene now

Add to cart