Login to display prices
Login to display prices
CHD9-chromodomain helicase DNA binding protein 9 Gene View larger

CHD9-chromodomain helicase DNA binding protein 9 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHD9-chromodomain helicase DNA binding protein 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHD9-chromodomain helicase DNA binding protein 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033770
Product type: DNA & cDNA
Ncbi symbol: CHD9
Origin species: Human
Product name: CHD9-chromodomain helicase DNA binding protein 9 Gene
Size: 2ug
Accessions: BC033770
Gene id: 80205
Gene description: chromodomain helicase DNA binding protein 9
Synonyms: ATP-dependent helicase CHD9; AD013; CHD-9; CReMM; KISH2; PRIC320; chromodomain-helicase-DNA-binding protein 9; PPAR-alpha-interacting complex protein 320 kDa; PPAR{gamma}-interacting cofactor 320 kDa; chromatin remodeling factor CHROM1; chromatin-related mesenchymal modulator; ciprofibrate bound protein p240; kismet homolog 2; peroxisomal proliferator-activated receptor A-interacting complex 320 kDa protein; proteinx0008; chromodomain helicase DNA binding protein 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttaatcaatcttttggtagcccagctgaacatgtgttatctccacactctcagtttaattgttctccaatccatccccaaaaccaacccaatggtttgtttccagatgtatcagatggcagtccaatgtggggccatcagacagctactaccatttcaaatcaaaatggatctccttttcaccaacaaggacattcacactctatgcatcaaaataaaagctttgtggcacaccatgactttgccttatttcaggccaatgaacaacaaacacagtgtacttcactacgctcacaacaaaacagaaataatctcaacccagggcagaattctcttagccagtctaaaaattttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine zipper, down-regulated in cancer 1
- ubiquitin-conjugating enzyme E2 variant 1
- calmodulin 2 (phosphorylase kinase, delta)
- trafficking protein particle complex 6A