Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CHD9-chromodomain helicase DNA binding protein 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHD9-chromodomain helicase DNA binding protein 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033770 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHD9 |
| Origin species: | Human |
| Product name: | CHD9-chromodomain helicase DNA binding protein 9 Gene |
| Size: | 2ug |
| Accessions: | BC033770 |
| Gene id: | 80205 |
| Gene description: | chromodomain helicase DNA binding protein 9 |
| Synonyms: | ATP-dependent helicase CHD9; AD013; CHD-9; CReMM; KISH2; PRIC320; chromodomain-helicase-DNA-binding protein 9; PPAR-alpha-interacting complex protein 320 kDa; PPAR{gamma}-interacting cofactor 320 kDa; chromatin remodeling factor CHROM1; chromatin-related mesenchymal modulator; ciprofibrate bound protein p240; kismet homolog 2; peroxisomal proliferator-activated receptor A-interacting complex 320 kDa protein; proteinx0008; chromodomain helicase DNA binding protein 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttaatcaatcttttggtagcccagctgaacatgtgttatctccacactctcagtttaattgttctccaatccatccccaaaaccaacccaatggtttgtttccagatgtatcagatggcagtccaatgtggggccatcagacagctactaccatttcaaatcaaaatggatctccttttcaccaacaaggacattcacactctatgcatcaaaataaaagctttgtggcacaccatgactttgccttatttcaggccaatgaacaacaaacacagtgtacttcactacgctcacaacaaaacagaaataatctcaacccagggcagaattctcttagccagtctaaaaattttatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine zipper, down-regulated in cancer 1 - ubiquitin-conjugating enzyme E2 variant 1 - calmodulin 2 (phosphorylase kinase, delta) - trafficking protein particle complex 6A |