Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LDOC1-leucine zipper, down-regulated in cancer 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LDOC1-leucine zipper, down-regulated in cancer 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003104 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LDOC1 |
| Origin species: | Human |
| Product name: | LDOC1-leucine zipper, down-regulated in cancer 1 Gene |
| Size: | 2ug |
| Accessions: | BC003104 |
| Gene id: | 23641 |
| Gene description: | leucine zipper, down-regulated in cancer 1 |
| Synonyms: | protein LDOC1; BCUR1; Mar7; Mart7; breast cancer, up-regulated 1; leucine zipper downregulated in cancer; leucine zipper protein down-regulated in cancer cells; leucine zipper down-regulated in cancer 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggatgagttggtgctgctgctgcacgcgctcctgatgcggcaccgcgccctgagcatcgagaacagccagctcatggaacagctgcggctgctggtgtgcgagagggccagcctgctgcgccaggtacgtccgccgagctgcccggtgcccttccccgaaacgtttaatggcgagagctcccggctccccgagtttatcgtgcagacggcgtcttacatgctcgtgaacgagaaccgattctgcaacgacgccatgaaggtggcattcctaatcagcctcctcaccggggaagccgaggagtgggtggtgccctacatcgagatggatagccccatcctaggtgattaccgggccttcctcgatgagatgaaacagtgctttggctgggatgacgacgaagacgacgacgacgaagaagaggaggatgattattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2 variant 1 - calmodulin 2 (phosphorylase kinase, delta) - trafficking protein particle complex 6A - MpV17 mitochondrial inner membrane protein |