PLAC8-placenta-specific 8 Gene View larger

PLAC8-placenta-specific 8 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLAC8-placenta-specific 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PLAC8-placenta-specific 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012205
Product type: DNA & cDNA
Ncbi symbol: PLAC8
Origin species: Human
Product name: PLAC8-placenta-specific 8 Gene
Size: 2ug
Accessions: BC012205
Gene id: 51316
Gene description: placenta-specific 8
Synonyms: C15; DGIC; PNAS-144; onzin; placenta-specific gene 8 protein; down-regulated in gastrointestinal cancer protein; placenta specific 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaagctcaggcgccggtggtcgttgtgacccaacctggagtcggtcccggtccggccccccagaactccaactggcagacaggcatgtgtgactgtttcagcgactgcggagtctgtctctgtggcacattttgtttcccgtgccttgggtgtcaagttgcagctgatatgaatgaatgctgtctgtgtggaacaggcgtcgcaatgaggactctctacaggacccgatatggcatccctggatctatttgtgatgactatatggcaactctttgctgtcctcattgtactctttgccaaatcaagccatctgattacagaaggagagccatgcgtactttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prefoldin subunit 2
- WD repeat domain 32
- ribosomal protein S6
- ribosomal protein S6

Buy PLAC8-placenta-specific 8 Gene now

Add to cart