PFDN2-prefoldin subunit 2 Gene View larger

PFDN2-prefoldin subunit 2 Gene

PTXBC012464

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PFDN2-prefoldin subunit 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PFDN2-prefoldin subunit 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012464
Product type: DNA & cDNA
Ncbi symbol: PFDN2
Origin species: Human
Product name: PFDN2-prefoldin subunit 2 Gene
Size: 2ug
Accessions: BC012464
Gene id: 5202
Gene description: prefoldin subunit 2
Synonyms: PFD2; prefoldin subunit 2; prefoldin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagaacagcggtcgcgccggcaagagcagcgggagcggcgcggggaagggggcggtgtccgcagagcaggtgattgctggcttcaaccgccttcggcaggaacagcgaggcctggcatccaaagcagctgagttggagatggagttgaatgagcacagcctagtgatcgatacactgaaggaggtagatgaaactcgtaagtgctaccgcatggttggaggagtgctggtggagcgaactgtcaaagaggtgctgcccgctttggagaacaacaaggagcagatacagaagatcattgagacactgacacagcagcttcaggcaaagggaaaagaactaaatgaattccgggaaaagcacaacattcgtctcatgggagaagatgagaagccagcagccaaggaaaactcagaaggggctggggctaaggccagctcagctggagtgttggtctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 32
- ribosomal protein S6
- ribosomal protein S6
- ribosomal protein L6

Buy PFDN2-prefoldin subunit 2 Gene now

Add to cart