RPS6-ribosomal protein S6 Gene View larger

RPS6-ribosomal protein S6 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS6-ribosomal protein S6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS6-ribosomal protein S6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013296
Product type: DNA & cDNA
Ncbi symbol: RPS6
Origin species: Human
Product name: RPS6-ribosomal protein S6 Gene
Size: 2ug
Accessions: BC013296
Gene id: 6194
Gene description: ribosomal protein S6
Synonyms: 40S ribosomal protein S6; phosphoprotein NP33; ribosomal protein S6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgaacatctccttcccagccactggctgccagaaactcattgaagtggacgatgaacgcaaacttcgtactttctatgagaagcgtatggccacagaagttgctgctgacgctctgggtgaagaatggaagggttatgtggtccgaatcagtggtgggaacgacaaacaaggtttccccatgaagcagggtgtcttgacccatggccgtgtccgcctgctactgagtaaggggcattcctgttacagaccaaggagaactggagaaagaaagagaaaatcagttcgtggttgcattgtggatgcaaatctgagcgttctcaacttggttattgtaaaaaaaggagagaaggatattcctggactgactgatactacagtgcctcgccgcctgggccccaaaagagctagcagaatccgcaaacttttcaatctctctaaagaagatgatgtccgccagtatgttgtaagaaagcccttaaataaagaaggtaagaaacctaggaccagagcacccaagattcagcgtcttgttactccacgtgtcctgcagcacaaacggcggcgtattgctctgaagaagcagcgtaccaagaaaaataaagaagaggctgcagaatatgctaaacttttggccaagagaatgaaggaggctaaggagaagcgccaggaacaaattgcgaagagacgcagactttcctctctgcgagcttctacttctaagtctgaatccagtcagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S6
- ribosomal protein L6
- WD repeat domain 61
- WD repeat domain 33

Buy RPS6-ribosomal protein S6 Gene now

Add to cart