Login to display prices
Login to display prices
WDR33-WD repeat domain 33 Gene View larger

WDR33-WD repeat domain 33 Gene

PTXBC013990

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR33-WD repeat domain 33 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDR33-WD repeat domain 33 Gene

Proteogenix catalog: PTXBC013990
Ncbi symbol: WDR33
Product name: WDR33-WD repeat domain 33 Gene
Size: 2ug
Accessions: BC013990
Gene id: 55339
Gene description: WD repeat domain 33
Synonyms: pre-mRNA 3' end processing protein WDR33; NET14; WD repeat-containing protein 33; WD repeat-containing protein WDC146; WD repeat domain 33
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctacagaaattggttctcctcctcgttttttccatatgccaaggttccagcaccaggcacctcgacagctgttttataagcgacctgattttgcacaacagcaagcaatgcaacagcttacttttgatggaaaacgaatgagaaaagctgtgaaccgaaaaaccatagactacaatccatctgtaattaagtatttggagaacagaatatggcaaagagaccagagagatatgcgggcaattcagcctgatgcaggttattacaatgatctggtcccacctataggaatgttgaataatcctatgaatgcagtaacaacaaaatttgttcggacatcaacaaataaagtaaagtgtcctgtatttgttgttaggtggactccagaaggaagacgcttggtcactggagcttctagtggggagtttaccctgtggaatggactcactttcaattttgaaacaatattacaggctcacgacagcccagtgagggccatgacgtggtcacataatgacatgtggatgttgacagcagaccacggaggatatgtgaaatattggcagtcgaacatgaacaacgtcaagatgttccaggcacataaggaggcgattagagaggccaggtttatacacaatataccattttctgtagtccctattgtcatggttaaattattctctaagtgtattctgggtgcagagatgcatgggctctgtcagtttctgggaaactttctgcaccctataaacacaatatttttctttgttttcacacattcaccattttgctggcacctttctgaagtagtgttgtcccggtatcagcctttgcaatatgttagagatgtactgtctgccgcattttgcactggttttctcttttcatttatgattaataatgtgtatacgttattcctttttattatctactgtgtaagacaagaatatttcattccaaataaagaattcagtctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: