Login to display prices
Login to display prices
DMRTC1-DMRT-like family C1 Gene View larger

DMRTC1-DMRT-like family C1 Gene

PTXBC029799

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DMRTC1-DMRT-like family C1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DMRTC1-DMRT-like family C1 Gene

Proteogenix catalog: PTXBC029799
Ncbi symbol: DMRTC1
Product name: DMRTC1-DMRT-like family C1 Gene
Size: 2ug
Accessions: BC029799
Gene id: 63947
Gene description: DMRT-like family C1
Synonyms: doublesex- and mab-3-related transcription factor C1; doublesex-mab-3; DMRT like family C1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcccctcccaaagctcccatccgtgtcaggaatttgaccatcagagcaggagccctcactgggaaggagaacaacatgctgcagcccgagacccacatcttcacagcccccgaggaggggagctcccaaggggctctgctgcttggccaggccccagaacctttgtctctgccctgtactccagtgaccttggagcagcaactggtttctccttctggggatccccacagggcccctgccctgcccagcatatgctcaactctgatcctccagccctgtgccacccttgaccctcttctactgcagccacaggtcctgggaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: