DMRTC1-DMRT-like family C1 Gene View larger

DMRTC1-DMRT-like family C1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DMRTC1-DMRT-like family C1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DMRTC1-DMRT-like family C1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029799
Product type: DNA & cDNA
Ncbi symbol: DMRTC1
Origin species: Human
Product name: DMRTC1-DMRT-like family C1 Gene
Size: 2ug
Accessions: BC029799
Gene id: 63947
Gene description: DMRT-like family C1
Synonyms: doublesex- and mab-3-related transcription factor C1; doublesex-mab-3; DMRT like family C1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcccctcccaaagctcccatccgtgtcaggaatttgaccatcagagcaggagccctcactgggaaggagaacaacatgctgcagcccgagacccacatcttcacagcccccgaggaggggagctcccaaggggctctgctgcttggccaggccccagaacctttgtctctgccctgtactccagtgaccttggagcagcaactggtttctccttctggggatccccacagggcccctgccctgcccagcatatgctcaactctgatcctccagccctgtgccacccttgaccctcttctactgcagccacaggtcctgggaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - centromere protein A
- SMAD family member 3
- thioredoxin-like 4A
- hemoglobin, epsilon 1

Buy DMRTC1-DMRT-like family C1 Gene now

Add to cart