Login to display prices
Login to display prices
CENPA-centromere protein A Gene View larger

CENPA-centromere protein A Gene

PTXBC000881

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CENPA-centromere protein A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CENPA-centromere protein A Gene

Proteogenix catalog: PTXBC000881
Ncbi symbol: CENPA
Product name: CENPA-centromere protein A Gene
Size: 2ug
Accessions: BC000881
Gene id: 1058
Gene description: centromere protein A
Synonyms: CENP-A; CenH3; histone H3-like centromeric protein A; centromere autoantigen A; centromere protein A, 17kDa; centromere-specific histone; centromere protein A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcccgcgccgccggagccgaaagcccgaggccccgaggaggcgcagcccgagcccgaccccgacccccggcccctcccggcggggcccctccttaggcgcttcctcccatcaacacagtcggcggagacaaggttggctaaaggagatccgaaagcttcagaagagcacacacctcttgataaggaagctgcccttcagccgcctggcagcagaagcatttctagttcatctctttgaggacgcctatctcctcaccttacatgcaggccgagttactctcttcccaaaggatgtgcaactggcccggaggatccggggccttgaggagggactcggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: