Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TXNL4A-thioredoxin-like 4A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TXNL4A-thioredoxin-like 4A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001046 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TXNL4A |
| Origin species: | Human |
| Product name: | TXNL4A-thioredoxin-like 4A Gene |
| Size: | 2ug |
| Accessions: | BC001046 |
| Gene id: | 10907 |
| Gene description: | thioredoxin-like 4A |
| Synonyms: | BMKS; DIB1; DIM1; SNRNP15; TXNL4; U5-15kD; thioredoxin-like protein 4A; DIM1 protein homolog; spliceosomal U5 snRNP-specific 15 kDa protein; thioredoxin-like 4; thioredoxin-like U5 snRNP protein U5-15kD; thioredoxin like 4A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtacatgctcccgcacctgcacaacggctggcaggtggaccaggccatcctctcggaggaggaccgcgtggtcgtcatccgcttcggccacgactgggatcctacgtgcatgaagatggacgaggtcctgtacagcatcgccgagaaggttaaaaattttgcagttatttatcttgtggatattacagaagtgcctgacttcaacaaaatgtatgagttatacgatccatgtactgtcatgtttttcttcaggaacaagcacatcatgattgacttggggactggcaacaacaacaagattaactgggccatggaggacaagcaggagatggtggacatcatcgagacggtgtaccgcggggcccgcaaaggccgcggcctggtggtgtcccccaaggactactccaccaagtaccgctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hemoglobin, epsilon 1 - bridging integrator 3 - exosome component 3 - pancreatic polypeptide |