TXNL4A-thioredoxin-like 4A Gene View larger

TXNL4A-thioredoxin-like 4A Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNL4A-thioredoxin-like 4A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TXNL4A-thioredoxin-like 4A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001046
Product type: DNA & cDNA
Ncbi symbol: TXNL4A
Origin species: Human
Product name: TXNL4A-thioredoxin-like 4A Gene
Size: 2ug
Accessions: BC001046
Gene id: 10907
Gene description: thioredoxin-like 4A
Synonyms: BMKS; DIB1; DIM1; SNRNP15; TXNL4; U5-15kD; thioredoxin-like protein 4A; DIM1 protein homolog; spliceosomal U5 snRNP-specific 15 kDa protein; thioredoxin-like 4; thioredoxin-like U5 snRNP protein U5-15kD; thioredoxin like 4A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgtacatgctcccgcacctgcacaacggctggcaggtggaccaggccatcctctcggaggaggaccgcgtggtcgtcatccgcttcggccacgactgggatcctacgtgcatgaagatggacgaggtcctgtacagcatcgccgagaaggttaaaaattttgcagttatttatcttgtggatattacagaagtgcctgacttcaacaaaatgtatgagttatacgatccatgtactgtcatgtttttcttcaggaacaagcacatcatgattgacttggggactggcaacaacaacaagattaactgggccatggaggacaagcaggagatggtggacatcatcgagacggtgtaccgcggggcccgcaaaggccgcggcctggtggtgtcccccaaggactactccaccaagtaccgctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hemoglobin, epsilon 1
- bridging integrator 3
- exosome component 3
- pancreatic polypeptide

Buy TXNL4A-thioredoxin-like 4A Gene now

Add to cart