GTF2A2-general transcription factor IIA, 2, 12kDa Gene View larger

GTF2A2-general transcription factor IIA, 2, 12kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GTF2A2-general transcription factor IIA, 2, 12kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GTF2A2-general transcription factor IIA, 2, 12kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000287
Product type: DNA & cDNA
Ncbi symbol: GTF2A2
Origin species: Human
Product name: GTF2A2-general transcription factor IIA, 2, 12kDa Gene
Size: 2ug
Accessions: BC000287
Gene id: 2958
Gene description: general transcription factor IIA, 2, 12kDa
Synonyms: HsT18745; T18745; TF2A2; TFIIA; TFIIA-12; TFIIA-gamma; TFIIAS; transcription initiation factor IIA subunit 2; TFIIA gamma subunit; TFIIA p12 subunit; general transcription factor IIA 2; general transcription factor IIA, 2, 12kDa; transcription initiation factor IIA gamma chain; general transcription factor IIA subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatatcagttatacagaaatactactttgggaaacagtcttcaggagagcctagatgagctcatacagtctcaacagatcaccccccaacttgcccttcaagttctacttcagtttgataaggctataaatgcagcactggctcagagggtcaggaacagagtcaatttcaggggctctctaaatacgtacagattctgcgataatgtgtggacttttgtactgaatgatgttgaattcagagaggtgacagaacttattaaagtggataaagtgaaaattgtagcctgtgatggtaaaaatactggctccaatactacagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transforming growth factor beta regulator 1
- T cell receptor gamma variable 7 pseudogene
- proline-rich nuclear receptor coactivator 2
- interleukin enhancer binding factor 3, 90kDa

Buy GTF2A2-general transcription factor IIA, 2, 12kDa Gene now

Add to cart