Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GTF2A2-general transcription factor IIA, 2, 12kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GTF2A2-general transcription factor IIA, 2, 12kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000287 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GTF2A2 |
| Origin species: | Human |
| Product name: | GTF2A2-general transcription factor IIA, 2, 12kDa Gene |
| Size: | 2ug |
| Accessions: | BC000287 |
| Gene id: | 2958 |
| Gene description: | general transcription factor IIA, 2, 12kDa |
| Synonyms: | HsT18745; T18745; TF2A2; TFIIA; TFIIA-12; TFIIA-gamma; TFIIAS; transcription initiation factor IIA subunit 2; TFIIA gamma subunit; TFIIA p12 subunit; general transcription factor IIA 2; general transcription factor IIA, 2, 12kDa; transcription initiation factor IIA gamma chain; general transcription factor IIA subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcatatcagttatacagaaatactactttgggaaacagtcttcaggagagcctagatgagctcatacagtctcaacagatcaccccccaacttgcccttcaagttctacttcagtttgataaggctataaatgcagcactggctcagagggtcaggaacagagtcaatttcaggggctctctaaatacgtacagattctgcgataatgtgtggacttttgtactgaatgatgttgaattcagagaggtgacagaacttattaaagtggataaagtgaaaattgtagcctgtgatggtaaaaatactggctccaatactacagaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transforming growth factor beta regulator 1 - T cell receptor gamma variable 7 pseudogene - proline-rich nuclear receptor coactivator 2 - interleukin enhancer binding factor 3, 90kDa |