SERF2-small EDRK-rich factor 2 Gene View larger

SERF2-small EDRK-rich factor 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERF2-small EDRK-rich factor 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERF2-small EDRK-rich factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008214
Product type: DNA & cDNA
Ncbi symbol: SERF2
Origin species: Human
Product name: SERF2-small EDRK-rich factor 2 Gene
Size: 2ug
Accessions: BC008214
Gene id: 10169
Gene description: small EDRK-rich factor 2
Synonyms: 4F5REL; FAM2C; H4F5REL; HsT17089; small EDRK-rich factor 2; gastric cancer-related protein VRG107; protein 4F5-related
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgggctttctgctgccgcccgcaagcagagggactcggagatcatgcagcagaagcagaaaaaggcaaacgagaagaaggaggaacccaagtagctttgtggcttcgtgtccaaccctcttgcccttcgcctgtgtgcctggagccagtcccaccacgctcgcgtttcctcctgtagtgctcacaggtcccagcaccgatggcattccctttgccctgagtctgcagcgggtcccttttgtgcttccttcccctcaggtagcctctctccccctgggccactcccgggggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 471
- ring finger protein 220
- zinc finger protein 593
- NTF2-like export factor 1

Buy SERF2-small EDRK-rich factor 2 Gene now

Add to cart