MT1E-metallothionein 1E Gene View larger

MT1E-metallothionein 1E Gene

PTXBC009699

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MT1E-metallothionein 1E Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MT1E-metallothionein 1E Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009699
Product type: DNA & cDNA
Ncbi symbol: MT1E
Origin species: Human
Product name: MT1E-metallothionein 1E Gene
Size: 2ug
Accessions: BC009699
Gene id: 4493
Gene description: metallothionein 1E
Synonyms: MT-1E; MT-IE; MT1; MTD; metallothionein-1E; metallothionein 1E (functional); metallothionein D; metallothionein-IE; metallothionein 1E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccccaactgctcttgcgccactggtggctcctgcacgtgcgccggctcctgcaagtgcaaagagtgcaaatgcacctcctgcaagaagagctgctgttcctgctgccccgtgggctgtgccaagtgtgcccagggctgcgtctgcaaaggggcatcggagaagtgcagctgctgtgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SPR pseudogene
- tumor protein D52
- cytochrome b-561
- metallothionein 1M

Buy MT1E-metallothionein 1E Gene now

Add to cart