Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MT1E-metallothionein 1E Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MT1E-metallothionein 1E Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009699 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MT1E |
| Origin species: | Human |
| Product name: | MT1E-metallothionein 1E Gene |
| Size: | 2ug |
| Accessions: | BC009699 |
| Gene id: | 4493 |
| Gene description: | metallothionein 1E |
| Synonyms: | MT-1E; MT-IE; MT1; MTD; metallothionein-1E; metallothionein 1E (functional); metallothionein D; metallothionein-IE; metallothionein 1E |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaccccaactgctcttgcgccactggtggctcctgcacgtgcgccggctcctgcaagtgcaaagagtgcaaatgcacctcctgcaagaagagctgctgttcctgctgccccgtgggctgtgccaagtgtgcccagggctgcgtctgcaaaggggcatcggagaagtgcagctgctgtgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SPR pseudogene - tumor protein D52 - cytochrome b-561 - metallothionein 1M |