MT1M-metallothionein 1M Gene View larger

MT1M-metallothionein 1M Gene

PTXBC028280

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MT1M-metallothionein 1M Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MT1M-metallothionein 1M Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028280
Product type: DNA & cDNA
Ncbi symbol: MT1M
Origin species: Human
Product name: MT1M-metallothionein 1M Gene
Size: 2ug
Accessions: BC028280
Gene id: 4499
Gene description: metallothionein 1M
Synonyms: MT-1M; MT-IM; MT1; MT1K; metallothionein-1M; metallothionein 1K; metallothionein 1Y; metallothionein 1M
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccccaactgctcctgcaccactggtgtctcctgcgcctgcaccggctcctgcaagtgcaaagagtgcaaatgcacctcctgcaagaagagctgctgctcctgctgccccgtgggctgtgccaagtgtgcccacggctgtgtctgcaaagggacgttggagaactgcagctgctgtgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acylglycerol kinase
- WD repeat domain 8
- tubulin, beta 2A
- tubulin, beta 2B

Buy MT1M-metallothionein 1M Gene now

Add to cart