MGC34796-SPR pseudogene Gene View larger

MGC34796-SPR pseudogene Gene

PTXBC034822

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC34796-SPR pseudogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC34796-SPR pseudogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034822
Product type: DNA & cDNA
Ncbi symbol: MGC34796
Origin species: Human
Product name: MGC34796-SPR pseudogene Gene
Size: 2ug
Accessions: BC034822
Gene id: 414927
Gene description: SPR pseudogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgctgcggcagctggaggccgagctgggcgccgggcggtctgacttgcgcgtggtgcgggtgcccgcagacctgggcgccgaggctggcttgcagcccgctgcttggggccttgcgtcagctccccaggaccgaggagctgcagcaactgctcttcatcaacaacgcgggctctcctggggatgtgtccaaaggcttcgtggacctgggtgactccactcaagtgaacaaagactgggcgctgaacttgacctccatgctctctctgccggacttgcagcgtctcgaaggccttaccaaccagtcctggcctcaacagaactgtggttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor protein D52
- cytochrome b-561
- metallothionein 1M
- acylglycerol kinase

Buy MGC34796-SPR pseudogene Gene now

Add to cart