C15orf50-chromosome 15 open reading frame 50 Gene View larger

C15orf50-chromosome 15 open reading frame 50 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C15orf50-chromosome 15 open reading frame 50 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C15orf50-chromosome 15 open reading frame 50 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031958
Product type: DNA & cDNA
Ncbi symbol: C15orf50
Origin species: Human
Product name: C15orf50-chromosome 15 open reading frame 50 Gene
Size: 2ug
Accessions: BC031958
Gene id: 414926
Gene description: chromosome 15 open reading frame 50
Synonyms: C15orf50; long intergenic non-protein coding RNA 593
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgataagctctgggttggagacgccctatctcagaggagctccaaacctgctcaaggccttttcttgccctctgcaactttcctgccaagcaattagcctccagggaagaagaggaaattggaacacggacacgcacagaggaaagaccaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 217
- chromosome 10 open reading frame 35
- chromosome 1 open reading frame 182
- chromosome 15 open reading frame 40

Buy C15orf50-chromosome 15 open reading frame 50 Gene now

Add to cart