Login to display prices
Login to display prices
CXorf22-chromosome X open reading frame 22 Gene View larger

CXorf22-chromosome X open reading frame 22 Gene

PTXBC027936

New product

Data sheet of CXorf22-chromosome X open reading frame 22 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CXorf22-chromosome X open reading frame 22 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC027936
Ncbi symbol: CXorf22
Product name: CXorf22-chromosome X open reading frame 22 Gene
Size: 2ug
Accessions: BC027936
Gene id: 170063
Gene description: chromosome X open reading frame 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacacccaaaagggttccctcaccataaacgtccacagaggttccctcgccatgagcatccaaaggggttccctcgtcccccgggatatggatagctcgggtagagacatgcagctgcgggtgatcccggctgaggtgaagttcctggacacgatggccgggagggtgtaccgcctcccgattactgtgcataatatttgccgctggaaccagaaaatccgatttaaggagcccgtcaagccacagttcaaactgatgttgaccagtctggataaagaacttgcttctggccttcagatgacagctatggtggaatatcatcctgataaagacgaagacacttttgaccggctacttatttcaatagaaaataaaacaacagaaattcctctaattgggttgattccatcctgtcaattggaaattgaatcagtagttaattttggcacactggttgccaatagtaaagtatattctaaagagattactatcactaaccatggcaaagctccaggcatatttaaggcagaataccacggccaattacccatcctcatttttccaactagtggtatcgtggatgctaagtcatcaatggttattaaagtagatttctgtgcagaccagccaagaattgtagatgaagaggcaatagtgattttgcaaggtcaacctgagatgctcttgagtatcaaagctcatgtggttgagcagattattgaattattaagcatgagtagtgacagaaggctggaatgcatacactttggtcctgttttcttcggatcatcaaaaattaaacatgcacgtgtatacaataatagcccagagcccataaattgggtggccatcatacaagatgatgccgtgggagaagaattgggtacagatattcaacaaagaacagatattgctttaaataatctcacctacataagaaaaataaagaacatagatactactatcattatctcctgtcttcctaatgaagggactttacaaccttatcaaaagactgtaattacattttgtttcaccccaaagctaatggctgttggtaaaaaggatattggaccttcatacagacaggactatgctctctttttgagatttgagtccgtaggaagtaaagatggatttttgagagatgatgactataaaaccatcaaaagtgaacgatttcagaaagtggaattagcactgacaggcacaggacttcctgttttactacagtttgatccaggaccagttcttaattttaaaccttgtttcatgggtgaacgttcagaaattcagtgcatcataaaaaatcaatgcgaattacttcctgtgacgtaccactttaaaaaaactgcaaattttgaaattgatcctgaaaagggcaagattactggagggggtatggtggatgtgatgtgttcatttgttccacatcaacttggagtcttcaaagtgaagcagatgatagagattattggtttagtggcagaagaagatttgcaatctttgtcggtaaaatctttccatcacgtatatttagctttcaacagcatctgtaaagcttccaccaagaaagttgtgatgaaatttgatcctggtatattgccttcgatccgtaatcccacgggaaagtttgtggtcaaagacttggcaaaacgcaagaattatgcacctgtagcaatgcttcaatcagccatgacacgcactcacaatcatcgctcatgtgaagagccagtgaaggatatgctattagcctttcccaatgaccgagctgcaactatcaggtctaaagaccatcataaacatttcaggccaattttcacaaaagttccaagatttaactatgtgaatcatgattttgcatatactacatttgaaaaacagcaaaagaaattatatgaaaactattatgcaatgtatcttaaatatttaagaagtgtgcgcttgcagaagaaacaagcagagagggagcgcatgtattcatatgatgatacagacataggcttagagccaggatcaggtctaaagtcaccctcactctcagaagcggaaatagaagaggagctgtcttcagcagcaaattcaattagagcgaatcgattgttaaccaccaggggtatagcatctcaggaggaagagtctgtgagaagaaaggttctcaaaggacttaaatcagaaccatccactccacaagaaaaacatgattgcagcttaatgttgacaccaaagcaaattcatcaagtaattgttgttagatactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: