MAP3K7IP3-mitogen-activated protein kinase kinase kinase 7 interacting protein 3 Gene View larger

MAP3K7IP3-mitogen-activated protein kinase kinase kinase 7 interacting protein 3 Gene


New product

Data sheet of MAP3K7IP3-mitogen-activated protein kinase kinase kinase 7 interacting protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAP3K7IP3-mitogen-activated protein kinase kinase kinase 7 interacting protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032526
Product type: DNA & cDNA
Ncbi symbol: MAP3K7IP3
Origin species: Human
Product name: MAP3K7IP3-mitogen-activated protein kinase kinase kinase 7 interacting protein 3 Gene
Size: 2ug
Accessions: BC032526
Gene id: 257397
Gene description: mitogen-activated protein kinase kinase kinase 7 interacting protein 3
Synonyms: MAP3K7IP3; NAP1; TGF-beta-activated kinase 1 and MAP3K7-binding protein 3; NF-kappa-B-activating protein 1; NFkB activating protein 1; TAB-3; TAK1-binding protein 3; TGF-beta-activated kinase 1-binding protein 3; mitogen-activated protein kinase kinase kinase 7 interacting protein 3; TGF-beta activated kinase 1/MAP3K7 binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcaaagcagcccacagcttgatattcaggttctccatgatcttcgacaacgtttccctgaaattccagagggcgtggtgtctcagtgcatgttacagaataacaacaatcttgaagcctgttgccgagccctttcccaggagagtagcaaatacttatatatggaataccatagtccagatgacaataggatgaatagaaatcgccttttacatattaacctgggtatccattctcctagtagctatcacccaggagatggagcccaacttaatggtggtcgaacactggtacatagctcaagtgatggacatattgatcctcagcatgcagcaggtaaacagctgatatgtttagttcaagaaccacactcagctccagctgttgttgctgctactcccaactacaatccattttttatgaacgaacagaacagaagtgcagctactcctccttcacaaccacctcaacagccatcttccatgcaaacaggaatgaatccgtctgctatgcaagggccttcaccaccaccgccacctccttcatacatgcacatacctcggtatagtacaaatccaattactgttacagtatcccagaacctcccttctggacagactgtaccaagagctttacaaattcttccacaaattccaagcaatctctatgggtctcctggttctatttatattagacagacatctcagagttcatcaggaagacaaactcctcagagtacgccgtggcagtcctcaccacagggcccagtgcctcactatagccagcgtcctttacctgtttatccacaccaacagaactatcagccttctcagtattctcccaaacagcagcagatccctcagtctgcttaccattcaccacctccttctcaatgtccttcacccttcagctctccacagcatcaagtgcaaccttcccagttgggccacatctttatgccacctagtccttcaactactccaccccatccatatcaacaaggacctcctagctatcagaaacagggaagccattcagtagcctatcttccatacacagcatctagtttatccaaaggttccatgaagaagatagaaattacagttgaaccttctcaaagacctgggacagcaattaataggagtccttcacccatcagtaatcaaccatctccacggaatcaacactcactgtacacagccaccacgccaccttcaagttctccttcaagagggatatctagtcaaccaaaacctccatttagtgttaatcctgtgtatattacatatacacagccaactggaccttcttgtactccatcaccatctcctcgagtgataccaaacccaactacagtttttaaaattaccgtaggccgagcaacgactgaaaatcttttaaatttagtggaccaagaagagcgctctgcagcaccagaacctattcagcccatttcagtgataccaggctctgggggagaaaagggaagccataaatatcagagaagttctagttctggatcagatgactatgcctacacacaagccttgctgttacatcaacgagcaaggatggagaggttagcaaagcaactgaaacttgagaaagaggagctagagcggttgaagtctgaagttaatggtatggagcatgacctgatgcagagacggctcagaagagtcagctgcaccactgcgatccctacgcctgaggaaatgacaagattgagaagcatgaacagacaactccagataaatgttgactgtacactgaaagaagttgacctccttcaatctagaggaaactttgatccaaaagccatgaataatttttatgacaacatagaacctggcccagttgtaccacccaagccatctaaaaaagactcctcagacccctgcacaattgagagaaaagcccgaagaattagcgtgacctccaaagtacaggcagacatccatgacacccaggcagcagctgcagatgagcatcgaactggctccacacaaagtcctcggacacaacctcgagatgaagactacgaaggggctccatggaattgtgatagctgcacctttcttaaccacccagcactaaatcgctgtgagcagtgcgagatgccacggtacacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
- KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
- myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)
- protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform

Buy MAP3K7IP3-mitogen-activated protein kinase kinase kinase 7 interacting protein 3 Gene now

Add to cart