Login to display prices
Login to display prices
EIF2B4-eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa Gene View larger

EIF2B4-eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa Gene

PTXBC001870

New product

Data sheet of EIF2B4-eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF2B4-eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC001870
Ncbi symbol: EIF2B4
Product name: EIF2B4-eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa Gene
Size: 2ug
Accessions: BC001870
Gene id: 8890
Gene description: eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Synonyms: EIF-2B; EIF2B; EIF2Bdelta; translation initiation factor eIF-2B subunit delta; eIF-2B GDP-GTP exchange factor subunit delta; eukaryotic translation initiation factor 2B subunit 4 delta; eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa; translation initiation factor eIF-2b delta subunit; eukaryotic translation initiation factor 2B subunit delta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctgtggccgtggctgttcgcgaggactcgggatccgggatgaaggcggagcttccccctgggcctggggcagtggggagggaaatgaccaaagaagaaaagctgcagcttcggaaggaaaagaaacagcagaagaagaaacggaaggaagaaaagggggcagaaccagagactggctctgctgtatctgcagcccaatgtcaagtaggcccaaccagagaactgccagaatcgggcattcagttgggcactcctcgggagaaagttccagctggtcggagtaaggccgaacttcgggctgagcgtcgagccaagcaggaggccgagcgggccctgaaacaggcaagaaaaggggaacaaggaggaccacctcctaaggccagccccagcacagctggagaaaccccctcaggagtgaagcgtctccctgagtaccctcaggttgatgacctacttctgagaaggcttgttaaaaaaccagagcgtcaacaggttcctacacgaaaggattatggatccaaagtcagtctcttctctcacctaccccagtacagcagacaaaactctctgacccagtttatgagcatcccatcctctgtgatccacccagccatggtgcgactcggcctgcagtactcccagggcctggtcagtggctccaatgcccggtgtattgccctgcttcgtgccttgcagcaggtgattcaggattacacaacaccgcctaatgaagaactctccagggatctagtgaataaactaaaaccctacatgagcttcctgactcagtgccgtcccctgtcagcgagcatgcacaacgccatcaagttccttaacaaggaaatcaccagtgtgggcagttccaagcgggaagaggaggccaagtcagaacttcgagcagccattgatcggtatgtgcaagagaagattgtgctagcagctcaggcaatttcacgctttgcttaccagaagatcagtaatggagatgtgatcctggtatatggatgctcatctctggtatcacgaattcttcaggaggcttggacagagggccggcggtttcgggtggtagtggtggacagccggccatggctggaaggaaggcacacactacgttctctagtccatgctggtgtcccagcctcctacctgctgattcctgcagcctcctatgtgctcccagaggtttccaaggtgctattgggagctcatgcactcttggccaacgggtctgtgatgtcacgggtagggacagcacagttagccctggtggctcgagcccataatgtaccagtgctggtttgctgtgaaacatacaagttctgtgagcgtgtgcagactgatgcctttgtctctaatgagctagatgaccctgatgatctgcaatgtaagcggggagaacatgttgcgctggctaactggcagaaccacgcatccctacggttgttgaatctagtctatgatgtgactcccccagagcttgtggatctggtgatcacggagctggggatgatcccttgcagttctgtacctgttgttctacgagtcaagagcagtgaccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: