Login to display prices
Login to display prices
EIF2B3-eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa Gene View larger

EIF2B3-eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF2B3-eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EIF2B3-eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018728
Product type: DNA & cDNA
Ncbi symbol: EIF2B3
Origin species: Human
Product name: EIF2B3-eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa Gene
Size: 2ug
Accessions: BC018728
Gene id: 8891
Gene description: eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa
Synonyms: EIF-2B; EIF2Bgamma; translation initiation factor eIF-2B subunit gamma; eIF-2B GDP-GTP exchange factor subunit gamma; eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa; eukaryotic translation initiation factor 2B subunit gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatttcaagcagtagtgatggcagtaggtggaggatctcggatgacagacctaacttccagcattcccaaacctctgcttccagttgggaacaaacctttaatttggtacccattgaacctgcttgagcgtgttggatttgaagaagtcattgtggttacaaccagggatgttcaaaaggctctatgtgcagaattcaagatgaaaatgaagccagatattgtgtgtattcctgatgacgctgacatgggaactgcagattctttgcgctacatatatccaaaacttaagacagatgtgctggtgctgagctgtgatctgataacagacgttgccttacatgaggttgtggacctgtttagagcttatgatgcatcacttgctatgttgatgagaaaaggccaagatagcatagaacctgttcccggtcaaaaggggaaaaaaaaagcagtggagcagcgtgacttcattggagtggacagcacaggaaagaggctgctcttcatggctaatgaagcagacttggatgaagagctggtcattaagggatccatcctacagaagcatcctagaatacgtttccacacgggtcttgtggatgcccacctctactgtttgaaaaaatacatcgtggatttcctaatggaaaatgggtcaataacttctatccggagtgaactgattccatatttagtgagaaaacagttttcctcagcttcctcacaacagggacaagaagaaaaagaggaggatctaaagaaaaaggagctgaagtccttagatatctacagttttataaaagaagccaatacactgaacctggctccctatgatgcctgctggaatgcctgtcgaggagacaggtgggaagacttgtccagatcacaggtgcgctgctatgtccacatcatgaaagaggggctctgctctcgagtgagcacactgggactctacatggaagcaaacagacaggtgcccaaattgctgtctgctctctgtccagaagaaccaccagtccattcgtcagcccagattgtcagcaaacacctggttggagttgacagcctcattgggccagagacacagattggagagaagtcatccattaagcgctcagtcattggctcatcctgtctcataaaagatagagtgactattaccaattgccttctcatgaactcagtcactgtggaggaaggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
- golgi associated, gamma adaptin ear containing, ARF binding protein 2
- potassium voltage-gated channel, subfamily H (eag-related), member 7
- processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)