Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EIF2B3-eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa Gene
PTXBC018728
New product
Data sheet of EIF2B3-eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF2B3-eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018728 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF2B3 |
| Origin species: | Human |
| Product name: | EIF2B3-eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa Gene |
| Size: | 2ug |
| Accessions: | BC018728 |
| Gene id: | 8891 |
| Gene description: | eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa |
| Synonyms: | EIF-2B; EIF2Bgamma; translation initiation factor eIF-2B subunit gamma; eIF-2B GDP-GTP exchange factor subunit gamma; eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa; eukaryotic translation initiation factor 2B subunit gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaatttcaagcagtagtgatggcagtaggtggaggatctcggatgacagacctaacttccagcattcccaaacctctgcttccagttgggaacaaacctttaatttggtacccattgaacctgcttgagcgtgttggatttgaagaagtcattgtggttacaaccagggatgttcaaaaggctctatgtgcagaattcaagatgaaaatgaagccagatattgtgtgtattcctgatgacgctgacatgggaactgcagattctttgcgctacatatatccaaaacttaagacagatgtgctggtgctgagctgtgatctgataacagacgttgccttacatgaggttgtggacctgtttagagcttatgatgcatcacttgctatgttgatgagaaaaggccaagatagcatagaacctgttcccggtcaaaaggggaaaaaaaaagcagtggagcagcgtgacttcattggagtggacagcacaggaaagaggctgctcttcatggctaatgaagcagacttggatgaagagctggtcattaagggatccatcctacagaagcatcctagaatacgtttccacacgggtcttgtggatgcccacctctactgtttgaaaaaatacatcgtggatttcctaatggaaaatgggtcaataacttctatccggagtgaactgattccatatttagtgagaaaacagttttcctcagcttcctcacaacagggacaagaagaaaaagaggaggatctaaagaaaaaggagctgaagtccttagatatctacagttttataaaagaagccaatacactgaacctggctccctatgatgcctgctggaatgcctgtcgaggagacaggtgggaagacttgtccagatcacaggtgcgctgctatgtccacatcatgaaagaggggctctgctctcgagtgagcacactgggactctacatggaagcaaacagacaggtgcccaaattgctgtctgctctctgtccagaagaaccaccagtccattcgtcagcccagattgtcagcaaacacctggttggagttgacagcctcattgggccagagacacagattggagagaagtcatccattaagcgctcagtcattggctcatcctgtctcataaaagatagagtgactattaccaattgccttctcatgaactcagtcactgtggaggaaggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa - golgi associated, gamma adaptin ear containing, ARF binding protein 2 - potassium voltage-gated channel, subfamily H (eag-related), member 7 - processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) |