STK32C-serine/threonine kinase 32C Gene View larger

STK32C-serine/threonine kinase 32C Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STK32C-serine/threonine kinase 32C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STK32C-serine/threonine kinase 32C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015792
Product type: DNA & cDNA
Ncbi symbol: STK32C
Origin species: Human
Product name: STK32C-serine/threonine kinase 32C Gene
Size: 2ug
Accessions: BC015792
Gene id: 282974
Gene description: serine/threonine kinase 32C
Synonyms: PKE; YANK3; serine/threonine-protein kinase 32C; PKE protein kinase; testicular tissue protein Li 187; yet another novel kinase 3; serine/threonine kinase 32C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacgccatgaagtacatgaacaagcagcagtgcatcgagcgcgacgaggtccgcaacgtcttccgggagctggagatcctgcaggagatcgagcacgtcttcctggtgaacctctggtactccttccaggacgaggaggacatgttcatggtcgtggacctgctactgggcggggacctgcgctaccacctgcagcagaacgtgcagttctccgaggacacggtgaggctgtacatctgcgagatggcactggctctggactacctgcgcggccagcacatcatccacagagatgtcaagcctgacaacattctcctggatgagagaggacatgcacacctgaccgacttcaacattgccaccatcatcaaggacggggagcgggcgacggcattagcaggcaccaagccgtacatggctccggagatcttccactcttttgtcaacggcgggaccggctactccttcgaggtggactggtggtcggtgggggtgatggcctatgagctgctgcgaggatggaggccctatgacatccactccagcaacgccgtggagtccctggtgcagctgttcagcaccgtgagcgtccagtatgtccccacgtggtccaaggagatggtggccttgctgcggaagctcctcactgtgaaccccgagcaccggctctccagcctccaggacgtgcaggcagccccggcgctggccggcgtgctgtgggaccacctgagcgagaagagggtggagccgggcttcgtgcccaacaaaggccgtctgcactgcgaccccacctttgagctggaggagatgatcctggagtccaggcccctgcacaagaagaagaagcgcctggccaagaacaagtcccgggacaacagcagggacagctcccagtccgagaatgactatcttcaagactgcctcgatgccatccagcaagacttcgtgatttttaacagagaaaagctgaagaggagccaggacctcccgagggagcctctccccgcccctgagtccagggatgctgcggagcctgtggaggacgaggcggaacgctccgccctgcccatgtgcggccccatttgcccctcggccgggagcggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine/threonine kinase 17b
- tumor suppressor candidate 4
- phosphogluconate dehydrogenase
- activin A receptor, type IB

Buy STK32C-serine/threonine kinase 32C Gene now

Add to cart