TUSC4-tumor suppressor candidate 4 Gene View larger

TUSC4-tumor suppressor candidate 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TUSC4-tumor suppressor candidate 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TUSC4-tumor suppressor candidate 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021984
Product type: DNA & cDNA
Ncbi symbol: TUSC4
Origin species: Human
Product name: TUSC4-tumor suppressor candidate 4 Gene
Size: 2ug
Accessions: BC021984
Gene id: 10641
Gene description: tumor suppressor candidate 4
Synonyms: TUSC4; FFEVF2; NPR2; NPR2L; nitrogen permease regulator 2-like protein; 2810446G01Rik; G21 protein; NPR2-like protein; gene 21 protein; homologous to yeast nitrogen permease (candidate tumor suppressor); tumor suppressor candidate 4; NPR2-like, GATOR1 complex subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcagcggctgccgcatcgaatgcatattcttcagcgagttccacctcacgctgggacccaagatcacctatcaggtccctgaagacttcatctcccgagagctgtttgacacagtccaagtgtacatcatcaccaagccagagctgcagaacaagcttatcactgtcacagctatggaaaagaagctgatcggctgtcctgtgtgcatcgaacacaagaagtacagccgcaatgctctcctcttcaacctgggcttcgtgtgtgatgcccaggccaagacctgcgccctcgagcccattgttaaaaagctggctggctatctgaccacactagagctagagagcagcttcgtgtccatggaggagagcaagcagaagttggtgcccatcatgaccatcttgctggaggagctaaatgcctcaggccggtgcactctgcccattgatgagtccaacaccatccacttgaaggtgattgagcagcggccagaccctccggtggcccaggagtatgatgtacctgtctttaccaaagacaaggaggatttcttcaactcacagtgggacctcactacacaacaaatcctgccctacattgatgggttccgccacatccagaagatttcagcagaggcagatgtggagctcaacctggtgcgcattgctatccagaacctgctgtactacggcgttgtgacactggtgtccatcctccagtactccaatgtatactgcccaacgcccaaggtccaggacctggtagatgacaagtccctgcaagaggcatgtctatcctacgtgaccaagcaagggcacaagagggccagtctccgggatgtgttccagctatactgcagcctgagccctggcactaccgtgcgagacctcattggccgccacccccagcagctgcagcatgttgatgaacggaagctgatccagttcgggcttatgaagaacctcatcaggcgactacagaagtatcctgtgcgggtgactcgggaagagcagagccaccctgcccggctttatacaggctgccacagctatgacgagatctgctgcaagacaggcatgagctaccatgagctggatgagcggcttgaaaatgaccccaacatcatcatctgctggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphogluconate dehydrogenase
- activin A receptor, type IB
- neutrophil cytosolic factor 2
- YTH domain family, member 2

Buy TUSC4-tumor suppressor candidate 4 Gene now

Add to cart