Login to display prices
Login to display prices
STK17B-serine/threonine kinase 17b Gene View larger

STK17B-serine/threonine kinase 17b Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STK17B-serine/threonine kinase 17b Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STK17B-serine/threonine kinase 17b Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016040
Product type: DNA & cDNA
Ncbi symbol: STK17B
Origin species: Human
Product name: STK17B-serine/threonine kinase 17b Gene
Size: 2ug
Accessions: BC016040
Gene id: 9262
Gene description: serine/threonine kinase 17b
Synonyms: DRAK2; serine/threonine-protein kinase 17B; DAP kinase-related apoptosis-inducing protein kinase 2; death-associated protein kinase-related 2; serine/threonine kinase 17b
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgaggaggagatttgattgccgaagtatttcaggcctactaactacaactcctcaaattccaataaaaatggaaaactttaataatttctatatacttacatctaaagagctagggagaggtaaatttgctgtggttagacaatgtatatcaaaatctactggccaagaatatgctgcaaaatttctaaaaaagagaagaagaggacaggattgtcgggcagaaattttacacgagattgctgtgcttgaattggcaaagtcttgtccccgtgttattaatcttcatgaggtctatgaaaatacaagtgaaatcattttgatattggaatatgctgcaggtggagaaattttcagcctgtgtttacctgagttggctgaaatggtttctgaaaatgatgttatcagactcattaaacaaatacttgaaggagtttattatctacatcagaataacattgtacaccttgatttaaagccacagaatatattactgagcagcatataccctctcggggacattaaaatagtagattttggaatgtctcgaaaaatagggcatgcgtgtgaacttcgggaaatcatgggaacaccagaatatttagctccagaaatcctgaactatgatcccattaccacagcaacagatatgtggaatattggtataatagcatatatgttgttaactcacacatcaccatttgtgggagaagataatcaagaaacatacctcaatatctctcaagttaatgtagattattcggaagaaactttttcatcagtttcacagctggccacagactttattcagagccttttagtaaaaaatccagagaaaagaccaacagcagagatatgcctttctcattcttggctacagcagtgggactttgaaaacttgtttcaccctgaagaaacttccagttcctctcaaactcaggatcattctgtaaggtcctctgaagacaagacttctaaatcctcctgtaatggaacctgtggtgatagagaagacaaagagaatatcccagaggatagcagcatggtttccaaaagatttcgtttcgatgactcattacccaatccccatgaacttgtttcagatttgctctgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor suppressor candidate 4
- phosphogluconate dehydrogenase
- activin A receptor, type IB
- neutrophil cytosolic factor 2