Login to display prices
Login to display prices
APOA1-apolipoprotein A-I Gene View larger

APOA1-apolipoprotein A-I Gene

PTXBC005380

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APOA1-apolipoprotein A-I Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APOA1-apolipoprotein A-I Gene

Proteogenix catalog: PTXBC005380
Ncbi symbol: APOA1
Product name: APOA1-apolipoprotein A-I Gene
Size: 2ug
Accessions: BC005380
Gene id: 335
Gene description: apolipoprotein A-I
Synonyms: apo(a); apolipoprotein A-I; apo-AI; apolipoprotein A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagctgcggtgctgaccttggccgtgctcttcctgacggggagccaggctcggcatttctggcagcaagatgaacccccccagagcccctgggatcgagtgaaggacctggccactgtgtacgtggatgtgctcaaagacagcggcagagactatgtgtcccagtttgaaggctccgccttgggaaaacagctaaacctaaagctccttgacaactgggacagcgtgacctccaccttcagcaagctgcgcgaacagctcggccctgtgacccaggagttctgggataacctggaaaaggagacagagggcctgaggcaggagatgagcaaggatctggaggaggtgaaggccaaggtgcagccctacctggacgacttccagaagaagtggcaggaggagatggagctctaccgccagaaggtggagccgctgcgcgcagagctccaagagggcgcgcgccagaagctgcacgagctgcaagagaagctgagcccactgggcgaggagatgcgcgaccgcgcgcgcgcccatgtggacgcgctgcgcacgcatctggccccctacagcgacgagctgcgccagcgcttggccgcgcgccttgaggctctcaaggagaacggcggcgccagactggccgagtaccacgccaaggccaccgagcatctgagcacgctcagcgagaaggccaagcccgcgctcgaggacctccgccaaggcctgctgcccgtgctggagagcttcaaggtcagcttcctgagcgctctcgaggagtacactaagaagctcaacacccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: