Login to display prices
Login to display prices
CLCN2-chloride channel 2 Gene View larger

CLCN2-chloride channel 2 Gene

PTXBC021578

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLCN2-chloride channel 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLCN2-chloride channel 2 Gene

Proteogenix catalog: PTXBC021578
Ncbi symbol: CLCN2
Product name: CLCN2-chloride channel 2 Gene
Size: 2ug
Accessions: BC021578
Gene id: 1181
Gene description: chloride channel 2
Synonyms: CIC-2; CLC2; ECA2; ECA3; EGI11; EGI3; EGMA; EJM6; EJM8; LKPAT; clC-2; chloride channel protein 2; chloride channel 2; chloride channel, voltage-sensitive 2; chloride voltage-gated channel 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcctggttcccagatggaattcatacggacagcagcacctaccggattgtgcctgggggctacgctgtggtcggggcagctgcgctggcaggagcggtgacacacacagtgtccacggctgtgatcgtgttcgagctcacaggccagattgcccacatcctgcctgtcatgatcgtcgtcatcctggccaacgctgtcgcccagagtctgcagccctccctctatgacagcatcatccgaatcaagaaactgccctacctgcctgagctcggctggggccgccaccagcagtaccgggtgcgtgtggaggacatcatggtgcgggatgttccccatgtggccctcagctgcaccttccgggacctgcgtttggcactgcacaggaccaagggccgaatgctggccctagtggagtcccctgagtccatgattctgctgggctccatcgagcgttcacaggtggtggcattgttgggggcccagctgagcccagcccgccggcggcagcacatgcaggagcgcagagccacccagacctctccactatctgatcaggagggtccccctacccctgaggcttctgtctgcttccaggtgaacacagaagactcagccttcccagcagcccggggggagacccacaagcccctaaagcctgcactcaagagggggcccagtgtcaccaggaacctcggagagagtcccacagggagcgcagagtcggcaggcatcgccctccggagcctcttctgtggcagtccaccccctgaggctgcttcggagaagttggaatcctgtgagaagcgcaagctgaagcgtgtccgaatctccctggcaagtgacgcggacctggaaggcgagatgagccctgaagagactcacactatcttctcactgctgggagtggaccatgcttatgtcaccagtattggcagactcattggaatcgttactctaaaggagctccggaaggccatcgagggctctgtcacagcacagggtgtgaaagtccggccgcccctcgccagcttccgagacagtgccaccagcagcagtgacacggagaccactgaggtgcatgcactctgggggccccactcccgtcatggcctcccccgggagggcagcccttccgacagcgacgacaaatgccaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: