RND2-Rho family GTPase 2 Gene View larger

RND2-Rho family GTPase 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RND2-Rho family GTPase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RND2-Rho family GTPase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018096
Product type: DNA & cDNA
Ncbi symbol: RND2
Origin species: Human
Product name: RND2-Rho family GTPase 2 Gene
Size: 2ug
Accessions: BC018096
Gene id: 8153
Gene description: Rho family GTPase 2
Synonyms: ARHN; RHO7; RhoN; rho-related GTP-binding protein RhoN; CTD-3199J23.4; GTP-binding protein Rho7; ras homolog gene family, member N; rho-related GTP-binding protein Rho7; Rho family GTPase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggacacttcaggttcctcttactatgataatgtccggcctctggcctatcctgattctgatgctgtgctcatctgcttcgacattagccgaccagaaacactggacagtgttctcaagaagtggcaaggagagactcaagagttctgccccaatgccaaggttgtgctggttggctgtaaactggacatgcggactgacctggccacactgagggagctgtccaagcagaggcttatccctgttacacatgagcagggcactgtgctggccaagcaggtgggggctgtgtcctatgttgagtgctcctcccggtcctctgagcgcagcgtcagggatgtcttccatgtggctacagtggcctcccttggccgtggccataggcagctgcgccgaactgactcacgccggggaatgcagcgatccgctcagctgtcaggacggccagaccgggggaatgagggcgagatacacaaggatcgagccaaaagctgcaacctcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - meiosis inhibitor 1
- tubulin, alpha 1b
- ATPase type 13A1
- D-amino-acid oxidase

Buy RND2-Rho family GTPase 2 Gene now

Add to cart