TXNL1-thioredoxin-like 1 Gene View larger

TXNL1-thioredoxin-like 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNL1-thioredoxin-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TXNL1-thioredoxin-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001156
Product type: DNA & cDNA
Ncbi symbol: TXNL1
Origin species: Human
Product name: TXNL1-thioredoxin-like 1 Gene
Size: 2ug
Accessions: BC001156
Gene id: 9352
Gene description: thioredoxin-like 1
Synonyms: HEL-S-114; TRP32; TXL-1; TXNL; Txl; thioredoxin-like protein 1; 32 kDa thioredoxin-related protein; epididymis secretory protein Li 114; thioredoxin-related 32 kDa protein; thioredoxin-related protein 1; thioredoxin like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgggggtgaagcccgtcgggagcgacccggatttccagccagagctgagcggcgcgggctccagactcgccgtggtcaagttcaccatgagagggtgtgggccatgtttgaggattgccccagcattcagttctatgagtaataaatatccacaggctgttttcttggaagtcgatgtacatcagtgtcagggaacagctgccaccaacaatatatcagcaacacctacatttttgttttttcgaaacaaagtgagaattgatcaatatcaaggagcagatgctgtgggattagaagaaaaaatcaagcagcacttagaaaatgaccctggaagcaatgaggacacagatattccaaaaggctatatggatttaatgccttttattaacaaagctggttgtgaatgtcttaatgaaagtgatgagcatggatttgacaactgtttacgaaaagacacaaccttcttggaatctgactgtgatgaacagctgcttattactgtggcattcaatcaacctgttaagctttattccatgaaatttcaagggccagataatggtcagggccctaaatatgtaaaaatttttatcaacctgccccgatctatggattttgaagaggcagaaagaagtgaaccaactcaagctctggaactgacagaggatgatattaaagaagatggcattgttccacttcgttatgttaagtttcagaatgttaacagtgtaactatatttgttcagtcgaatcaaggtgaagaggaaacaacaagaatttcatattttacttttattggtactccagtccaggcaacaaatatgaatgacttcaaacgagtagttggcaaaaaaggagaaagccactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - follistatin-like 1
- chloride channel 2
- chromobox homolog 6
- nucleoporin like 1

Buy TXNL1-thioredoxin-like 1 Gene now

Add to cart