Login to display prices
Login to display prices
ATP5F1-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 Gene View larger

ATP5F1-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5F1-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5F1-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 Gene

Proteogenix catalog: PTXBC005960
Ncbi symbol: ATP5F1
Product name: ATP5F1-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 Gene
Size: 2ug
Accessions: BC005960
Gene id: 515
Gene description: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1
Synonyms: PIG47; ATP synthase F(0) complex subunit B1, mitochondrial; ATP synthase B chain, mitochondrial; ATP synthase proton-transporting mitochondrial F(0) complex subunit B1; ATP synthase subunit b, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b; ATPase subunit b; H+-ATP synthase subunit b; cell proliferation-inducing protein 47; ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtcccgggtggtactttccgccgccgccacagcggccccctctctgaagaatgcagccttcctaggtccaggggtattgcaggcaacaaggacctttcatacagggcagccacaccttgtccctgtaccacctcttcctgaatacggaggaaaagttcgttatggactgatccctgaggaattcttccagtttctttatcctaaaactggtgtaacaggaccctatgtactcggaactgggcttatcttgtacgctttatccaaaggaatatatgtgattagcgcagagaccttcactgccctatcagtactaggtgtaatggtctatggaattaaaaaatatggtccctttgttgcagactttgctgataaactcaatgagcaaaaacttgcccaactagaagaggcgaagcaggcttccatccaacacatccagaatgcaattgatacggagaagtcacaacaggcactggttcagaagcgccattacctttttgatgtgcaaaggaataacattgctatggctttggaagttacttaccgggaacgactgtatagagtatataaggaagtaaggaatcgcctggactatcatatatctgtgcagaacatgatgcgtcgaaaggaacaagaacacatgataaattgggtggagaagcacgtggtgcaaagcatctccacacagcaggaaaaggagacaattgccaagtgcattgcggacctaaagctgctggcaaagaaggctcaagcacagccagttatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: