Login to display prices
Login to display prices
CTSG-cathepsin G Gene View larger

CTSG-cathepsin G Gene

PTXBC014460

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTSG-cathepsin G Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTSG-cathepsin G Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014460
Product type: DNA & cDNA
Ncbi symbol: CTSG
Origin species: Human
Product name: CTSG-cathepsin G Gene
Size: 2ug
Accessions: BC014460
Gene id: 1511
Gene description: cathepsin G
Synonyms: CATG
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagccactcctgcttctgctggcctttctcctacccactggggctgaggcaggggagatcatcggaggccgggagagcaggccccactcccgcccctacatggcgtatcttcagatccagagtccagcaggtcagagcagatgtggagggttcctggtgcgagaagactttgtgctgacagcagctcattgctggggaagcaatataaatgtcaccctgggcgcccacaatatccagagacgggaaaacacccagcaacacatcactgcgcgcagagccatccgccaccctcaatataatcagcggaccatccagaatgacatcatgttattgcagctgagcagaagagtcagacggaatcgaaacgtgaacccagtggctctgcctagagcccaggagggactgagacccgggacgctgtgcactgtggccggctggggcagggtcagcatgaggaggggaacagatacactccgagaggtgcagctgagagtgcagagggataggcagtgcctccgcatcttcggttcctacgacccccgaaggcagatttgtgtgggggaccggcgggaacggaaggctgccttcaagggggattccggaggccccctgctgtgtaacaatgtggcccacggcatcgtctcctatggaaagtcgtcaggggttcctccagaagtcttcaccagggtctcaagtttcctgccctggataaggacaacaatgagaagcttcaaactgctggatcagatggagacccccctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myozenin 2
- secernin 2
- cathepsin A
- hexokinase 1