KRT81-keratin 81 Gene View larger

KRT81-keratin 81 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRT81-keratin 81 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KRT81-keratin 81 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021241
Product type: DNA & cDNA
Ncbi symbol: KRT81
Origin species: Human
Product name: KRT81-keratin 81 Gene
Size: 2ug
Accessions: BC021241
Gene id: 3887
Gene description: keratin 81
Synonyms: HB1; Hb-1; KRTHB1; MLN137; ghHkb1; hHAKB2-1; keratin, type II cuticular Hb1; K81; MLN 137; ghHb1; hair keratin K2.9; hard keratin, type II, 1; keratin 81, type II; keratin, hair, basic, 1; metastatic lymph node 137 gene protein; type II hair keratin Hb1; type-II keratin Kb21; keratin 81
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggccacggtgatcaggcacggggagaccctgcgccgcaccaaggaggagatcaacgagctgaaccgcatgatccagaggctgacggccgaggtggagaatgccaagtgccagaactccaagctggaggccgcggtggcccagtctgagcagcagggtgaggcggccctcagtgatgcccgctgcaagctggccgagctggagggcgccctgcagaaggccaagcaggacatggcctgcctgatcagggagtaccaggaggtgatgaactccaagctgggcctggacatcgagatcgccacctacaggcgcctgctggagggcgaggagcagaggctatgtgaaggcattggggctgtgaatgtctgtgtcagcagctcccggggcggggtcgtgtgcggggacctctgcgtgtcaggctcccggccagtgactggcagtgtctgcagcgctccgtgcaacgggaacgtggcggtgagcaccggcctgtgtgcgccctgcggccaattgaacaccacctgcggagggggttcctgcggcgtgggctcctgtggtatcagctccctgggtgtggggtcttgcggcagcagctgccggaaatgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - oncostatin M
- cathepsin G
- myozenin 2
- secernin 2

Buy KRT81-keratin 81 Gene now

Add to cart