Login to display prices
Login to display prices
ASB13-ankyrin repeat and SOCS box-containing 13 Gene View larger

ASB13-ankyrin repeat and SOCS box-containing 13 Gene

PTXBC012056

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASB13-ankyrin repeat and SOCS box-containing 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ASB13-ankyrin repeat and SOCS box-containing 13 Gene

Proteogenix catalog: PTXBC012056
Ncbi symbol: ASB13
Product name: ASB13-ankyrin repeat and SOCS box-containing 13 Gene
Size: 2ug
Accessions: BC012056
Gene id: 79754
Gene description: ankyrin repeat and SOCS box-containing 13
Synonyms: ankyrin repeat and SOCS box protein 13; ankyrin repeat domain-containing SOCS box protein Asb-13; ankyrin repeat and SOCS box containing 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccccgggcggcggacggctgcttcctgggcgacgtgggtttctgggtggagcggacccctgtgcacgaggcagcccagcggggtgagagcctgcagctgcaacagctgatcgagagcggcgcctgcgtgaaccaggtcaccgtggactccatcacgcccctgcacgcagccagtctgcagggccaggcgcggtgtgtgcagctgctgctggcggctggggcccaggtggatgctcgcaacatcgacggcagcaccccgctctgcgatgcctgcgcctcgggcagcatcgagtgtgtgaagctcttgctgtcctacggggccaaggtcaaccctcccctgtacacagcgtcccccctgcacgaggcctgcatgagcgggagttccgaatgtgtgaggcttcttattgacgtcggggccaatctggaagcgcacgattgccattttgggacccctctgcacgttgcctgtgcccgggagcatctggactgtgtcaaagtgctgctcaatgcagcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: