Login to display prices
Login to display prices
DDAH2-dimethylarginine dimethylaminohydrolase 2 Gene View larger

DDAH2-dimethylarginine dimethylaminohydrolase 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDAH2-dimethylarginine dimethylaminohydrolase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DDAH2-dimethylarginine dimethylaminohydrolase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001435
Product type: DNA & cDNA
Ncbi symbol: DDAH2
Origin species: Human
Product name: DDAH2-dimethylarginine dimethylaminohydrolase 2 Gene
Size: 2ug
Accessions: BC001435
Gene id: 23564
Gene description: dimethylarginine dimethylaminohydrolase 2
Synonyms: DDAH; DDAHII; G6a; HEL-S-277; NG30; N(G),N(G)-dimethylarginine dimethylaminohydrolase 2; S-phase protein; dimethylargininase-2; dimethylarginine dimethylaminohydrolase II; epididymis secretory protein Li 277; testis tissue sperm-binding protein Li 54e; dimethylarginine dimethylaminohydrolase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggacgccgggggaggggctgggccgctgctcccatgccctgatccggggagtcccagagagcctggcgtcgggggaaggtgcgggggctggccttcccgctctggatctggccaaagctcaaagggagcacggggtgctgggaggtaaactgaggcaacgactggggctacagctgctagaactgccacctgaggagtcattgccgctgggaccgctgcttggcgacacggccgtgatccaaggggacacggccctaatcacgcggccctggagccccgctcgtaggccagaggtcgatggagtccgcaaagccctgcaagacctggggctccgaattgtggaaataggagacgagaacgcgacgctggatggcactgacgttctcttcaccggccgggagtttttcgtaggcctctccaaatggaccaatcaccgaggagctgagatcgtggcggacacgttccgggacttcgccgtctccactgtgccagtctcgggtccctcccacctgcgcggtctctgcggcatggggggacctcgcactgttgtggcaggcagcagcgacgctgcccaaaaggctgtccgggcaatggcagtgctgacagatcacccatatgcctccctgaccctcccagatgacgcagctgctgactgtctctttcttcgtcctgggttgcctggtgtgccccctttcctcctgcaccgtggaggtggggatctgcccaacagccaggaggcactgcagaagctctctgatgtcaccctggtacctgtgtcctgctcagaactggagaaggctggcgccgggctcagctccctctgcttggtgctcagcacacgcccccacagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - regulating synaptic membrane exocytosis 3
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 17
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
- carnitine palmitoyltransferase 1A (liver)