NCAPH2-non-SMC condensin II complex, subunit H2 Gene View larger

NCAPH2-non-SMC condensin II complex, subunit H2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NCAPH2-non-SMC condensin II complex, subunit H2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NCAPH2-non-SMC condensin II complex, subunit H2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000473
Product type: DNA & cDNA
Ncbi symbol: NCAPH2
Origin species: Human
Product name: NCAPH2-non-SMC condensin II complex, subunit H2 Gene
Size: 2ug
Accessions: BC000473
Gene id: 29781
Gene description: non-SMC condensin II complex, subunit H2
Synonyms: CAPH2; condensin-2 complex subunit H2; CAP-H2 subunit of the condensin II complex; CTA-384D8.36; chromosome-associated protein H2; kleisin beta; non-SMC condensin II complex subunit H2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacttcattgaggcagcgttgttgatccagggctctgcctgcgtctacagtaagaaggtggaatacctctactcactcgtctaccaggcccttgatttcatctctggaaagaggcgggccaagcagctctcttcggtgcaggaggacagggccaatggggttgccagctccggggtcccccaggaggcagagaatgagttcctgtcgctggatgacttccctgactcccggactaacgtggatctcaagaatgatcagacgcccagtgaggtcctcatcatccccctcctgcccatggccctggtggcccctgatgaaatggagaagaacaacaatcccctgtacagccgtcagggtgaggtcctggccagccggaaggatttcaggatgaacacgtgcgttccccaccccagaggggccttcatgttggagccagagggcatgtcccccatggaaccagcgggcgtttcccccatgccagggacccagaaggacaccgggaggactgaggagcagccaatggaagtttccgtgtgcaggagccctgtcccagcactcggcttctcccaggagccaggcccctctccagaaggcccgatgcccctgggtgggggcgaggacgaggatgcagaggaggcagtagagcttcctgaggcctcggcccccaaggccgctctggagcccaaggagtccaggagcccgcagcaggtgggacccacatggaggcctgcagaacctgagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dimethylarginine dimethylaminohydrolase 2
- regulating synaptic membrane exocytosis 3
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 17
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 50

Buy NCAPH2-non-SMC condensin II complex, subunit H2 Gene now

Add to cart