Login to display prices
Login to display prices
NCAPH2-non-SMC condensin II complex, subunit H2 Gene View larger

NCAPH2-non-SMC condensin II complex, subunit H2 Gene

PTXBC000473

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NCAPH2-non-SMC condensin II complex, subunit H2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NCAPH2-non-SMC condensin II complex, subunit H2 Gene

Proteogenix catalog: PTXBC000473
Ncbi symbol: NCAPH2
Product name: NCAPH2-non-SMC condensin II complex, subunit H2 Gene
Size: 2ug
Accessions: BC000473
Gene id: 29781
Gene description: non-SMC condensin II complex, subunit H2
Synonyms: CAPH2; condensin-2 complex subunit H2; CAP-H2 subunit of the condensin II complex; CTA-384D8.36; chromosome-associated protein H2; kleisin beta; non-SMC condensin II complex subunit H2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacttcattgaggcagcgttgttgatccagggctctgcctgcgtctacagtaagaaggtggaatacctctactcactcgtctaccaggcccttgatttcatctctggaaagaggcgggccaagcagctctcttcggtgcaggaggacagggccaatggggttgccagctccggggtcccccaggaggcagagaatgagttcctgtcgctggatgacttccctgactcccggactaacgtggatctcaagaatgatcagacgcccagtgaggtcctcatcatccccctcctgcccatggccctggtggcccctgatgaaatggagaagaacaacaatcccctgtacagccgtcagggtgaggtcctggccagccggaaggatttcaggatgaacacgtgcgttccccaccccagaggggccttcatgttggagccagagggcatgtcccccatggaaccagcgggcgtttcccccatgccagggacccagaaggacaccgggaggactgaggagcagccaatggaagtttccgtgtgcaggagccctgtcccagcactcggcttctcccaggagccaggcccctctccagaaggcccgatgcccctgggtgggggcgaggacgaggatgcagaggaggcagtagagcttcctgaggcctcggcccccaaggccgctctggagcccaaggagtccaggagcccgcagcaggtgggacccacatggaggcctgcagaacctgagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: