HMP19-HMP19 protein Gene View larger

HMP19-HMP19 protein Gene

PTXBC002619

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMP19-HMP19 protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HMP19-HMP19 protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002619
Product type: DNA & cDNA
Ncbi symbol: HMP19
Origin species: Human
Product name: HMP19-HMP19 protein Gene
Size: 2ug
Accessions: BC002619
Gene id: 51617
Gene description: HMP19 protein
Synonyms: HMP19 protein; neuron-specific protein family member 2; NSG2; hypothalamus golgi apparatus expressed 19 kDa protein; p19 protein; protein p19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgaagctgaacagtaaccccagcgagaagggaaccaagccgccttcagttgaggatggcttccagaccgtccctctcatcactcccttggaggttaatcacttacagctgcctgctccagaaaaggtgattgtgaagacaagaacggaatatcagccggaacagaagaacaaagggaagttccgggtgccgaaaatcgctgaatttacggtcaccatccttgtcagcctggccctagctttccttgcgtgcatcgtgttcctggtggtttacaaagccttcacctatgatcacagctgcccagagggattcgtctataagcacaaacgctgtatcccagcctccctggatgcttactactcctcccaggaccccaattccagaagccgcttctacacagtcatcagccactacagcgtggccaagcagagcactgcccgggccatcgggccgtggctgtcagcagccgctgtcatccatgagcccaagccgcccaagacccagggccactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transgelin 2
- homeobox B13
- formin-like 2
- interleukin 11

Buy HMP19-HMP19 protein Gene now

Add to cart