Login to display prices
Login to display prices
HMP19-HMP19 protein Gene View larger

HMP19-HMP19 protein Gene

PTXBC002619

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMP19-HMP19 protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HMP19-HMP19 protein Gene

Proteogenix catalog: PTXBC002619
Ncbi symbol: HMP19
Product name: HMP19-HMP19 protein Gene
Size: 2ug
Accessions: BC002619
Gene id: 51617
Gene description: HMP19 protein
Synonyms: HMP19 protein; neuron-specific protein family member 2; NSG2; hypothalamus golgi apparatus expressed 19 kDa protein; p19 protein; protein p19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgaagctgaacagtaaccccagcgagaagggaaccaagccgccttcagttgaggatggcttccagaccgtccctctcatcactcccttggaggttaatcacttacagctgcctgctccagaaaaggtgattgtgaagacaagaacggaatatcagccggaacagaagaacaaagggaagttccgggtgccgaaaatcgctgaatttacggtcaccatccttgtcagcctggccctagctttccttgcgtgcatcgtgttcctggtggtttacaaagccttcacctatgatcacagctgcccagagggattcgtctataagcacaaacgctgtatcccagcctccctggatgcttactactcctcccaggaccccaattccagaagccgcttctacacagtcatcagccactacagcgtggccaagcagagcactgcccgggccatcgggccgtggctgtcagcagccgctgtcatccatgagcccaagccgcccaagacccagggccactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: