Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNAJB12-DnaJ (Hsp40) homolog, subfamily B, member 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJB12-DnaJ (Hsp40) homolog, subfamily B, member 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011812 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJB12 |
| Origin species: | Human |
| Product name: | DNAJB12-DnaJ (Hsp40) homolog, subfamily B, member 12 Gene |
| Size: | 2ug |
| Accessions: | BC011812 |
| Gene id: | 54788 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily B, member 12 |
| Synonyms: | DJ10; dnaJ homolog subfamily B member 12; DnaJ (Hsp40) homolog, subfamily B, member 12; DnaJ heat shock protein family (Hsp40) member B12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttctttggcggcggcttcccttctagtaacgtccacgtctacagcaacggccgcatgcgctatacctaccagcaaaggcaggaccgcagggacaaccagggtgatggcgggctaggggtgtttgtgcagctgatgcctatcctcatcctgattctcgtgtcagctctcagccagctcatggtctccagtccaccctacagtctgagtccaagaccgtccgtgggccacatccacaggcgagtcactgaccacctgggtgtcgtctactatgtgggagacactttttccgaagagtacacaggctccagcctcaaaacagtcgagcggaatgtggaagatgattatatcgccaacctccggaacaactgctggaaggagaagcagcagaaggaaggcttgctgtaccgggcacgctactttggcgacacagatatgtaccacagagcacagaagatgggcacccccagctgcagccgactgtcagaggtgcaggcctccctgcatggatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hematological and neurological expressed 1-like - protein disulfide isomerase family A, member 5 - DnaJ (Hsp40) homolog, subfamily C, member 17 - Rab geranylgeranyltransferase, alpha subunit |