Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HN1L-hematological and neurological expressed 1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HN1L-hematological and neurological expressed 1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014438 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HN1L |
| Origin species: | Human |
| Product name: | HN1L-hematological and neurological expressed 1-like Gene |
| Size: | 2ug |
| Accessions: | BC014438 |
| Gene id: | 90861 |
| Gene description: | hematological and neurological expressed 1-like |
| Synonyms: | C16orf34; L11; hematological and neurological expressed 1-like protein; CRAMP_1 like; HN1 like; HN1-like protein; hematological and neurological expressed 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttccaggtcccggatagcgagggcggccgcgccggctccagggccatgaagcccccaggaggagaatcgagcaatctttttggaagtccagaagaagctactccttccagcaggcctaataggatggcatctaatatttttggaccaacagaagaacctcagaacatacccaagaggacaaatcccccagggggtaaaggaagtggtatctttgacgaatcaacccccgtgcagactcgacagcacctgaacccacctggagggaagaccagcgacatttttgggtctccggtcactgccacttcacgcttggcacacccaaacaaacccaaggatcatgttttcttatgtgaaggagaagaaccaaaatcggatcttaaagctgcaaggagcatcccggctggagcagagccaggtgagaaaggcagcgccagaaaagcaggccccgccaaggagcaggagcccatgcccacagtcgacagccatgagccccggctggggccgcggcctcgctctcacaacaaggtcctgaacccaccgggaggcaaatccagcatctccttctactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein disulfide isomerase family A, member 5 - DnaJ (Hsp40) homolog, subfamily C, member 17 - Rab geranylgeranyltransferase, alpha subunit - ectodermal-neural cortex (with BTB-like domain) |