Login to display prices
Login to display prices
HN1L-hematological and neurological expressed 1-like Gene View larger

HN1L-hematological and neurological expressed 1-like Gene

PTXBC014438

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HN1L-hematological and neurological expressed 1-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HN1L-hematological and neurological expressed 1-like Gene

Proteogenix catalog: PTXBC014438
Ncbi symbol: HN1L
Product name: HN1L-hematological and neurological expressed 1-like Gene
Size: 2ug
Accessions: BC014438
Gene id: 90861
Gene description: hematological and neurological expressed 1-like
Synonyms: C16orf34; L11; hematological and neurological expressed 1-like protein; CRAMP_1 like; HN1 like; HN1-like protein; hematological and neurological expressed 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccaggtcccggatagcgagggcggccgcgccggctccagggccatgaagcccccaggaggagaatcgagcaatctttttggaagtccagaagaagctactccttccagcaggcctaataggatggcatctaatatttttggaccaacagaagaacctcagaacatacccaagaggacaaatcccccagggggtaaaggaagtggtatctttgacgaatcaacccccgtgcagactcgacagcacctgaacccacctggagggaagaccagcgacatttttgggtctccggtcactgccacttcacgcttggcacacccaaacaaacccaaggatcatgttttcttatgtgaaggagaagaaccaaaatcggatcttaaagctgcaaggagcatcccggctggagcagagccaggtgagaaaggcagcgccagaaaagcaggccccgccaaggagcaggagcccatgcccacagtcgacagccatgagccccggctggggccgcggcctcgctctcacaacaaggtcctgaacccaccgggaggcaaatccagcatctccttctactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: