RABGGTA-Rab geranylgeranyltransferase, alpha subunit Gene View larger

RABGGTA-Rab geranylgeranyltransferase, alpha subunit Gene

PTXBC003093

New product

Data sheet of RABGGTA-Rab geranylgeranyltransferase, alpha subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RABGGTA-Rab geranylgeranyltransferase, alpha subunit Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC003093
Product type: DNA & cDNA
Ncbi symbol: RABGGTA
Origin species: Human
Product name: RABGGTA-Rab geranylgeranyltransferase, alpha subunit Gene
Size: 2ug
Accessions: BC003093
Gene id: 5875
Gene description: Rab geranylgeranyltransferase, alpha subunit
Synonyms: PTAR3; geranylgeranyl transferase type-2 subunit alpha; Rab GG transferase alpha; Rab GGTase alpha; geranylgeranyl transferase type II subunit alpha; protein prenyltransferase alpha subunit repeat containing 3; rab geranyl-geranyltransferase subunit alpha; Rab geranylgeranyltransferase alpha subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcacggacgcctgaaggtgaagacgtcagaagagcaggcggaggccaaaaggctagagcgagagcagaagctgaagctataccagtcagccacccaggccgtattccagaagcgccaggctggtgagctggatgagtccgtgctggaactgacaagccagattctgggagccaaccctgattttgccaccctctggaactgccgacgagaggtgctccagcagctggagactcagaagtctcctgaagagttggctgctctggtgaaggcagaactgggcttcctggagagctgcctgcgggtgaaccccaagtcttatggtacctggcaccaccgatgctggctgctaggccgcctgcctgagcccaactggacccgagagctggagctctgtgcccgtttcctggaggtggatgagcggaactttcactgctgggactatcggcggtttgtggccacacaggcagccgtgccccctgcagaagagctagccttcactgacagcctcatcacccgaaacttctccaactactcttcctggcattaccgctcctgtctcttgccccagctgcacccccagccggattctggaccacaggggcgcctccctgaggatgtgctgctcaaagagctggagctggtgcagaatgccttcttcactgaccccaatgaccagagtgcctggttttatcaccgttggctcctaggccgagctgacccccaggatgcactgcgctgcctgcatgtgagccgggacgaggcctgtctgactgtctccttctctcggcccctcttagtgggctccaggatggagatcttgctgctcatggttgatgattctcccctgattgtggagtggaggaccccagatggcaggaaccggcccagccatgtctggctctgtgacctgcctgctgcctccctcaacgaccagttgccccaacatacatttcgcgtcatttggacagcaggcgatgtccagaaagaatgcgtgcttttaaaaggccgccaggagggctggtgccgggactccacgacagacgagcagctattcaggtgtgagctgtcagtggagaagtccacagtgctgcagtctgagctggaatcctgtaaggagctgcaggagctggagcctgagaataaatggtgcctgcttaccatcatcctgctgatgcgggcactggaccccctgctgtatgagaaggagaccctgcagtacttccagaccctcaaggccgtggaccccatgcgggcaacgtatctggatgacctgcgcagcaagttcttgctggagaatagcgtgctcaagatggagtatgccgaggtgcgtgtgctgcacctggctcacaaggatctgacagtgctctgccatctggaacagctgctcttggtcacccatcttgacttgtcacacaatcgcctccgaaccctgccacctgcactggctgccctgcgctgccttgaggtgctgcaggccagtgataatgccatagagtccctggacggcgtcaccaacctaccccggctgcaggagctgctactgtgcaacaaccgcctccagcagcctgcagtgctccagcctcttgcctcctgccccaggctggtcctcctcaacctgcagggtaacccgctgtgccaagcggtgggcatcttggagcaactggctgaactgctgccttcagttagcagcgtcctcacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ectodermal-neural cortex (with BTB-like domain)
- protein disulfide isomerase family A, member 4
- acyl-CoA synthetase long-chain family member 5
- ClpB caseinolytic peptidase B homolog (E. coli)

Buy RABGGTA-Rab geranylgeranyltransferase, alpha subunit Gene now

Add to cart