Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of H2AFX-H2A histone family, member X Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about H2AFX-H2A histone family, member X Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004915 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | H2AFX |
| Origin species: | Human |
| Product name: | H2AFX-H2A histone family, member X Gene |
| Size: | 2ug |
| Accessions: | BC004915 |
| Gene id: | 3014 |
| Gene description: | H2A histone family, member X |
| Synonyms: | H2A.X; H2A/X; histone H2AX; H2AX histone; histone H2A.x; H2A histone family member X |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgggccgcggcaagactggcggcaaggcccgcgccaaggccaagtcgcgctcgtcgcgcgccggcctccagttcccagtgggccgtgtacaccggctgctgcggaagggccactacgccgagcgcgttggcgccggcgcgccagtgtacctggcggcagtgctggagtacctcaccgctgagatcctggagctggcgggcaatgcggcccgcgacaacaagaagacgcgaatcatcccccgccacctgcagctggccatccgcaacgacgaggagctcaacaagctgctgggcggcgtgacgatcgcccagggaggcgtcctgcccaacatccaggccgtgctgctgcccaagaagaccagcgccaccgtggggccgaaggcgccctcgggcggcaagaaggccacccaggcctcccaggagtactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ORM1-like 3 (S. cerevisiae) - ORM1-like 2 (S. cerevisiae) - tubulin, alpha pseudogene - four and a half LIM domains 3 |