Login to display prices
Login to display prices
HYPK-Huntingtin interacting protein K Gene View larger

HYPK-Huntingtin interacting protein K Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HYPK-Huntingtin interacting protein K Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HYPK-Huntingtin interacting protein K Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019262
Product type: DNA & cDNA
Ncbi symbol: HYPK
Origin species: Human
Product name: HYPK-Huntingtin interacting protein K Gene
Size: 2ug
Accessions: BC019262
Gene id: 25764
Gene description: Huntingtin interacting protein K
Synonyms: C15orf63; HSPC136; huntingtin-interacting protein K; huntingtin yeast partner K; huntingtin interacting protein K
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggcggcgtggtgaaatagatatggcgaccgagggggatgtggagctggagttggagactgagaccagtggaccagagcggcctccggagaagccacggaaacatgacagcggtgcggcggacttggagcgggtcaccgactatgcagaggagaaggagatccagagttccaatctggagacggccatgtctgtgattggagacagaaggtcccgggagcagaaagccaaacaggagcgggagaaagaactggcaaaagtcactatcaagaaggaagatctggagctaataatgactgagatggagatatctcgagcagcagcagaacgcagtttgcgggaacacatgggcaacgtggtagaggcgcttattgccctaaccaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TSC22 domain family, member 1
- Wilms tumor 1 associated protein
- ubiquitously-expressed transcript
- slingshot homolog 2 (Drosophila)