FOSL2-FOS-like antigen 2 Gene View larger

FOSL2-FOS-like antigen 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FOSL2-FOS-like antigen 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FOSL2-FOS-like antigen 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008899
Product type: DNA & cDNA
Ncbi symbol: FOSL2
Origin species: Human
Product name: FOSL2-FOS-like antigen 2 Gene
Size: 2ug
Accessions: BC008899
Gene id: 2355
Gene description: FOS-like antigen 2
Synonyms: FRA2; fos-related antigen 2; FOS like 2, AP-1 trancription factor subunit; FOS like antigen 2; FRA-2; FOS like 2, AP-1 transcription factor subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgtgggcctggaccttccccagatgctgccaggcagcccctccccaagcctcaaagaagcatttgctgaggatggagaggcaggggagggaggcgggaggccgtcactggagtggcgtctgcagcagctgctgccccagcacccgctcagcctgtcctggctgctcacctccccgcagggcaccgggcctttcctgccctctgtggtcatctgccacctgctggatcaagtgctttctcttttacactcccctgtccccaccccagtgcactcttctggcccaggcagcaagcaagctgtgaacagctggcctgagctgtcgctgtggcttgtggctcatgcgccattcctggttgtctgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hemoglobin, gamma A
- hemoglobin, gamma A
- apolipoprotein A-I
- thioredoxin-like 1

Buy FOSL2-FOS-like antigen 2 Gene now

Add to cart