Login to display prices
Login to display prices
EPB41L3-erythrocyte membrane protein band 4.1-like 3 Gene View larger

EPB41L3-erythrocyte membrane protein band 4.1-like 3 Gene

PTXBC008377

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EPB41L3-erythrocyte membrane protein band 4.1-like 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EPB41L3-erythrocyte membrane protein band 4.1-like 3 Gene

Proteogenix catalog: PTXBC008377
Ncbi symbol: EPB41L3
Product name: EPB41L3-erythrocyte membrane protein band 4.1-like 3 Gene
Size: 2ug
Accessions: BC008377
Gene id: 23136
Gene description: erythrocyte membrane protein band 4.1-like 3
Synonyms: 4.1B; DAL-1; DAL1; band 4.1-like protein 3; differentially expressed in adenocarcinoma of the lung protein 1; erythrocyte membrane protein band 4.1 like 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtgcaaagtgatacttctcgatggatcagaatatacctgtgatgtagagaaacgctccagaggacaagtgctgtttgataaagtgtgtgaacacttgaacttgctagagaaagactactttgggcttacgtatcgagatgctgaaaaccagaagaattggttggaccctgctaaggaaataaaaaaacaggttcgaagtggtgcttggcacttttcatttaatgtgaaattttatccaccagaccctgcccaactatctgaagatatcaccaggtactacctctgcttgcagttgcgagatgacatcgtgtccggaaggctgccctgctcctttgttaccctggccttgctgggctcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice