INS-insulin Gene View larger

INS-insulin Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of INS-insulin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about INS-insulin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005255
Product type: DNA & cDNA
Ncbi symbol: INS
Origin species: Human
Product name: INS-insulin Gene
Size: 2ug
Accessions: BC005255
Gene id: 3630
Gene description: insulin
Synonyms: IDDM; IDDM1; IDDM2; ILPR; IRDN; MODY10; preproinsulin; proinsulin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - apelin
- maestro
- coilin
- latexin

Buy INS-insulin Gene now

Add to cart